ID: 1041271497

View in Genome Browser
Species Human (GRCh38)
Location 8:56113579-56113601
Sequence CCTAGGCTATTGGACCCTGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 69}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041271492_1041271497 -9 Left 1041271492 8:56113565-56113587 CCATGATGATGGTCCCTAGGCTA 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1041271497 8:56113579-56113601 CCTAGGCTATTGGACCCTGCGGG 0: 1
1: 0
2: 0
3: 10
4: 69
1041271490_1041271497 -2 Left 1041271490 8:56113558-56113580 CCGAACTCCATGATGATGGTCCC 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1041271497 8:56113579-56113601 CCTAGGCTATTGGACCCTGCGGG 0: 1
1: 0
2: 0
3: 10
4: 69
1041271489_1041271497 1 Left 1041271489 8:56113555-56113577 CCACCGAACTCCATGATGATGGT 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1041271497 8:56113579-56113601 CCTAGGCTATTGGACCCTGCGGG 0: 1
1: 0
2: 0
3: 10
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041271497 Original CRISPR CCTAGGCTATTGGACCCTGC GGG Exonic
902160087 1:14523065-14523087 CCTAGTCTACTGGTCCCTCCAGG + Intergenic
902935416 1:19761427-19761449 CCCAGACTTTTGGATCCTGCCGG + Intronic
911205273 1:95086263-95086285 CCTAGTCTTTTGGACTCTGTTGG + Intergenic
911637405 1:100249986-100250008 CCTAGGATCTGGGACCCAGCGGG + Intergenic
912679389 1:111719552-111719574 CCTGGGCTTCAGGACCCTGCTGG - Intronic
924009112 1:239644843-239644865 CCCAGGCCATGGGACCCTGCTGG - Intronic
1065644087 10:27816417-27816439 CCTAGGATATTGAACGATGCTGG - Intronic
1066075459 10:31870963-31870985 CCTAGGCTATTGGCTCCTCAAGG - Intronic
1067183096 10:44005300-44005322 CCCAGGCTCTGGGGCCCTGCGGG - Intergenic
1070457602 10:76632738-76632760 CCTAGGCTATGGCATTCTGCAGG - Intergenic
1071457200 10:85860083-85860105 CCTGGGCTGTTGGCCCCTGGTGG - Intronic
1076108966 10:127846522-127846544 CCTTGGCTCTTTGCCCCTGCTGG + Intergenic
1076332338 10:129679299-129679321 CCTCTGCTGTGGGACCCTGCGGG + Intronic
1076854691 10:133110110-133110132 CCTGGAGTCTTGGACCCTGCTGG - Intronic
1082793988 11:57366912-57366934 AAGAGGCGATTGGACCCTGCGGG - Intronic
1085757773 11:79215870-79215892 CCAAGGCCATTGGATCCTGGAGG + Exonic
1088100212 11:106146420-106146442 CCTAGGATATTGGATCTTGCTGG - Intergenic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1090400167 11:126443831-126443853 CCAAAGCTCTGGGACCCTGCAGG - Intronic
1090722384 11:129488304-129488326 CCCAGGCCATTGGACCCTCAGGG + Intergenic
1091081102 11:132669134-132669156 CCTAAGCTATTGGGGCCTGTGGG - Intronic
1093805081 12:23422307-23422329 CCTGGGCTATATGACCCTGCAGG - Intergenic
1096184070 12:49566918-49566940 CCTAGCTTATGGGACCCTGGGGG - Intronic
1102914857 12:116745096-116745118 CCTGGGCTTTTGGAGCCAGCAGG + Intronic
1102991411 12:117318879-117318901 CCAAGGCTGTTGGAGCATGCAGG - Intronic
1118505309 14:66404564-66404586 CCTAGACTATTGGATCTTGCAGG - Intergenic
1118593970 14:67421770-67421792 CCTAGGCTATTGTGCTTTGCGGG + Intergenic
1122267252 14:100552495-100552517 CCAGGGCTGTTGGGCCCTGCCGG + Intronic
1124256936 15:28151984-28152006 CCGAGGCTATTGGCCCATGAGGG - Intronic
1127564718 15:60175877-60175899 CCAAGTCTATTTGACCATGCAGG + Intergenic
1127965752 15:63921682-63921704 CCTAGGCCATTGGGCCTTGAAGG - Intronic
1129264458 15:74386486-74386508 CTCAGGCTCCTGGACCCTGCTGG + Intergenic
1129888456 15:79055175-79055197 CTTAGACTATTGGAGCCAGCAGG - Intronic
1133924082 16:10180381-10180403 AGTGGGCTATTGGACCCTGCTGG - Exonic
1140332652 16:74072855-74072877 CCTAGGCTTAGGGACCTTGCCGG - Intergenic
1145069203 17:19788682-19788704 CCTAGGCTCTTGGACATTTCTGG + Intronic
1151906640 17:77053425-77053447 CCTAGCCCATTGCACCCTGTGGG + Intergenic
1155123001 18:22841930-22841952 CCTAGGCTCCTGGCTCCTGCTGG - Intronic
1156059964 18:33062903-33062925 CCTAGGCTATAAGACACTGTGGG - Intronic
1157118465 18:44884742-44884764 TCTATTCTACTGGACCCTGCTGG + Intronic
1168696986 19:58409135-58409157 CCCCGGCCATTGGACCGTGCGGG - Exonic
925306208 2:2849497-2849519 CCTTGGCTGTGGGGCCCTGCAGG + Intergenic
926530482 2:14038808-14038830 CCTAGGCTTCTGCACACTGCAGG + Intergenic
928373234 2:30756299-30756321 CATAGGCTATTGCACCCAGCTGG - Intronic
933435911 2:82249704-82249726 CCTAGGATATTGGATCTTGCTGG + Intergenic
934993066 2:98935123-98935145 ACTAGGTTATTGGAGCCTGCAGG - Intronic
937139866 2:119590725-119590747 CAAAGGCTGCTGGACCCTGCAGG - Intronic
938176910 2:129142130-129142152 CCTTGGCTGCTGGATCCTGCTGG - Intergenic
942572490 2:177328049-177328071 CCTAGGCTGTTGGGCACTGTAGG - Intronic
1169803831 20:9539310-9539332 CCTGGTCTGTTGAACCCTGCCGG + Exonic
1171302714 20:24077821-24077843 CCTAGGCCATAGGATGCTGCTGG + Intergenic
1184591942 22:45490782-45490804 CCTAGGATATTGGATCTTGCTGG - Intergenic
950653392 3:14421953-14421975 TCTCGGCTCTTGGACCCAGCAGG + Intronic
952701701 3:36335535-36335557 CTTAGGATATTGGATCTTGCTGG + Intergenic
956934524 3:74084845-74084867 CCTGGGCTATTTGACTCTACAGG + Intergenic
961157227 3:124690445-124690467 CCCAGGCTCTTGGTCCTTGCTGG + Intronic
962501220 3:135995147-135995169 CCCAGGCTTTTGGTCTCTGCTGG - Intronic
963260143 3:143184180-143184202 CCCAGTCTTTTGGTCCCTGCTGG + Intergenic
964644615 3:158945473-158945495 CCTAGGGTATCAGAGCCTGCAGG + Intergenic
969490275 4:7495740-7495762 CCTAGGCTCTTGAACAATGCAGG + Intronic
977570117 4:98620478-98620500 CTTAGGCTTGTGGACTCTGCAGG - Intronic
984349359 4:178570646-178570668 CTTAGGATATTGGATCTTGCTGG - Intergenic
989377734 5:40782422-40782444 CCTGGGCTATGGGACCTTCCCGG + Intronic
992904699 5:81334749-81334771 CCTTGGCTATAGCACCCCGCAGG - Intronic
993786651 5:92147272-92147294 TCAAGGCTAATGGACCCTGAGGG - Intergenic
999405042 5:151299495-151299517 CCTAGGCCCTAGCACCCTGCTGG - Intronic
1017421173 6:154274698-154274720 CCCAGTCTAATGGCCCCTGCAGG - Intronic
1019892381 7:3956620-3956642 CCCAGGACATTGGCCCCTGCAGG + Intronic
1024244070 7:47456229-47456251 CCTGGGCTCCTGGAGCCTGCTGG - Intronic
1025009784 7:55386853-55386875 TGTAGGATATTGGACCTTGCTGG + Intronic
1031462403 7:122067789-122067811 CCTGCCCTCTTGGACCCTGCTGG + Intergenic
1041271497 8:56113579-56113601 CCTAGGCTATTGGACCCTGCGGG + Exonic
1050030617 9:1381642-1381664 CCCATGCTGTTGGACCCTTCAGG - Intergenic
1061078578 9:128356425-128356447 CCTGGGCTTCTGGCCCCTGCTGG - Intronic
1061169862 9:128946382-128946404 CCTAGCCTATTGGTCTCTGCTGG - Exonic
1188106036 X:26148117-26148139 CATGGGCTCTTTGACCCTGCTGG - Intergenic
1197907709 X:131443842-131443864 CAAAGTCTAGTGGACCCTGCAGG - Intergenic
1197912049 X:131493218-131493240 CAAAGTCTAGTGGACCCTGCAGG - Intergenic
1200210986 X:154346518-154346540 CCCAGGCCATAGGACCCGGCAGG + Intergenic
1200219866 X:154385574-154385596 CCCAGGCCATAGGACCCGGCAGG - Intergenic