ID: 1041275697

View in Genome Browser
Species Human (GRCh38)
Location 8:56155650-56155672
Sequence CAGGGTAGAGAAAAGGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041275685_1041275697 27 Left 1041275685 8:56155600-56155622 CCATGGGGTGTGTGTAGGTGGGG No data
Right 1041275697 8:56155650-56155672 CAGGGTAGAGAAAAGGAGTAGGG No data
1041275694_1041275697 -9 Left 1041275694 8:56155636-56155658 CCATTTGTGAGGAACAGGGTAGA No data
Right 1041275697 8:56155650-56155672 CAGGGTAGAGAAAAGGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041275697 Original CRISPR CAGGGTAGAGAAAAGGAGTA GGG Intergenic
No off target data available for this crispr