ID: 1041279082

View in Genome Browser
Species Human (GRCh38)
Location 8:56193578-56193600
Sequence GAGTAGAATTATCAGTTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041279082_1041279084 -7 Left 1041279082 8:56193578-56193600 CCAATCAACTGATAATTCTACTC 0: 1
1: 0
2: 1
3: 13
4: 134
Right 1041279084 8:56193594-56193616 TCTACTCTACTGAGGCTAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041279082 Original CRISPR GAGTAGAATTATCAGTTGAT TGG (reversed) Intronic
902353634 1:15879319-15879341 GAGTAGCATTATACTTTGATGGG + Intronic
904809780 1:33155856-33155878 TAGTAGACTTATCAGGTGTTGGG - Intronic
907061236 1:51428113-51428135 GTATAGAATTCTCAGTTGACAGG - Intronic
907069500 1:51520776-51520798 GAGTAGAATTAGGAGTTCCTTGG - Intergenic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
911111469 1:94192295-94192317 GAGTAGACCTATCACTGGATAGG - Intronic
911764676 1:101659383-101659405 GAGTAGAATTAGCAGTTGGCAGG - Intergenic
915750256 1:158200906-158200928 AAGTAGAATTCTAAGTTGATGGG - Intergenic
916334102 1:163650608-163650630 GAGGAGAATTTTCTGTTCATGGG - Intergenic
918384549 1:183992666-183992688 GAATAGAGTTATCAGTTGAAAGG + Intronic
923942113 1:238839824-238839846 GAGTAAAATTTTCAGGTCATAGG - Intergenic
924320892 1:242848945-242848967 GACTAGATTTGTAAGTTGATTGG - Intergenic
1068889842 10:62137038-62137060 GAGTAGAATTTCTAGTTCATCGG + Intergenic
1068930512 10:62584339-62584361 TAGTAGGATAAACAGTTGATTGG + Intronic
1070310362 10:75268928-75268950 GAGTAAAAATATAAGATGATAGG + Intergenic
1071236942 10:83660217-83660239 TAGTAGAATTATCAGGTGAGGGG - Intergenic
1073986566 10:109216299-109216321 AACTAGAATTATCAGTACATGGG + Intergenic
1076370852 10:129952201-129952223 GAATATAATTATCATTGGATAGG - Intronic
1077708947 11:4516212-4516234 GAGTAAAATTATGAGTTAAAGGG - Intergenic
1079758170 11:24292771-24292793 GAGTGGAAATATCAATTGAATGG - Intergenic
1080139358 11:28897310-28897332 GAGTAGAATTACTAGGTCATAGG - Intergenic
1082318601 11:50765341-50765363 GAGTTGAACTATCTTTTGATTGG - Intergenic
1082760115 11:57119195-57119217 GAATAGAATTAACATTTGTTTGG - Intergenic
1087230244 11:95653065-95653087 GAGTGGAATTATAAATGGATGGG + Intergenic
1088086235 11:105983963-105983985 GAGTGGTATTATCAGGAGATGGG - Intergenic
1088883301 11:113988340-113988362 GAGCAGAAGTAGCAGTGGATTGG + Intronic
1089920048 11:122200967-122200989 TATTTGATTTATCAGTTGATTGG + Intergenic
1092317628 12:7435677-7435699 GAGTAGAATTAGCAGGTTCTGGG - Intronic
1093062972 12:14626501-14626523 AAGTAGAGTTATAAGCTGATTGG - Intronic
1093174464 12:15896759-15896781 AAGTAGAATTATCAGTTCAAAGG + Intronic
1093615913 12:21224334-21224356 GAGTAGAATTACAATTTTATGGG - Intronic
1093714081 12:22361814-22361836 GAATAAAAATATCAGTGGATGGG + Intronic
1094124425 12:27008077-27008099 GAGTAGAATTATCAGGTAATAGG + Intronic
1094180688 12:27589916-27589938 TAATAGATTTCTCAGTTGATAGG + Intronic
1098710597 12:73754875-73754897 GAGTGGAATTATCAGGTCAGTGG - Intergenic
1100142048 12:91631317-91631339 GAGTAGAATTTTCAAGTGAGAGG - Intergenic
1102336920 12:112089420-112089442 GAGTAGAATTTTCAAGTCATGGG - Intronic
1104060413 12:125263240-125263262 GAGTGGAATGAACATTTGATGGG + Intronic
1107954146 13:45494348-45494370 GAGTAGAATAATTACTTGAAAGG - Intronic
1107971969 13:45652091-45652113 CAGTTTAAATATCAGTTGATTGG + Intergenic
1108121856 13:47196590-47196612 GAGGAGAATTATCAGACAATTGG - Intergenic
1109657283 13:65409626-65409648 GAGAAGGATTATCATTTGAAAGG + Intergenic
1109679752 13:65734730-65734752 TAGTAGAATTATAAGTGGATTGG - Intergenic
1110268434 13:73566250-73566272 GAGTAGAATTATCTCATAATAGG - Intergenic
1112002779 13:95227131-95227153 AAATACAATTATCAGATGATGGG + Intronic
1114697628 14:24642547-24642569 GAGTAGAATTATTAGAAGCTGGG - Intergenic
1117610014 14:57473516-57473538 GATCAGAATTATCAGGTGATAGG - Intronic
1117860569 14:60088250-60088272 CAGTAGAATTATTAGTAGACTGG - Intergenic
1118531614 14:66712675-66712697 AAGTAGAACTACCATTTGATTGG - Intronic
1123879691 15:24665799-24665821 GTATAGAATTCTCAGTTGACAGG + Intergenic
1126202383 15:46001847-46001869 GTGCTGAATTATAAGTTGATTGG + Intergenic
1126615326 15:50573170-50573192 AAGTAGATTCAGCAGTTGATGGG - Intronic
1126865353 15:52931444-52931466 GAGGAGTATAAGCAGTTGATTGG + Intergenic
1131640211 15:94284117-94284139 GAGTAGAATTATTGGTTTGTAGG - Intronic
1134361255 16:13533095-13533117 GAGAAGAATGATCAGATGAAGGG - Intergenic
1135126949 16:19818798-19818820 GAGTAAAAAAATCAGTTGAATGG + Intronic
1139692481 16:68650102-68650124 GAGCAGAATTCTGAGTTGTTGGG - Intronic
1139802269 16:69532887-69532909 GAGTAGCATTCTCAGTAAATTGG + Intergenic
1142946404 17:3433010-3433032 GAGTAGAACTATTAGCTGATGGG + Exonic
1146327060 17:31895832-31895854 GAGTAGAAATATGGATTGATGGG - Intronic
1151092469 17:71458384-71458406 GAGAAGAATGACCAGTTTATAGG + Intergenic
1152489964 17:80624537-80624559 TAGTAGAAGTATTGGTTGATAGG + Intronic
1153120192 18:1714769-1714791 GTGTACAATTTTCAGCTGATGGG - Intergenic
1153558820 18:6349169-6349191 GAGTAGAATTGTTAGGTCATAGG - Intronic
1157382304 18:47229853-47229875 GAGTAGAACTAACAGTTTTTAGG + Intronic
1159555306 18:69939615-69939637 GAGTAGAATTATTGGATCATAGG + Intronic
1162599881 19:11660356-11660378 CTGTAAAATAATCAGTTGATAGG - Intergenic
1165016944 19:32888186-32888208 GAGTCAAGTTATGAGTTGATTGG - Intronic
1166235368 19:41451846-41451868 GTGTATACTTCTCAGTTGATGGG + Intergenic
928555768 2:32423249-32423271 GAGTAGAATTATTGGGTCATGGG + Intronic
934705811 2:96479326-96479348 GAGTAGAATTGCCAGGTCATAGG + Intergenic
934724595 2:96607622-96607644 GAGTAGAAGTGTGAGTGGATGGG - Intronic
935801802 2:106704881-106704903 GTGTACACTGATCAGTTGATGGG + Intergenic
939461122 2:142496195-142496217 CAATAGAATTATCAGCTGATGGG + Intergenic
939691812 2:145272520-145272542 GTATAGAATTCTAAGTTGATAGG - Intergenic
939705624 2:145448916-145448938 GAGCAGAATTATAAGATAATTGG + Intergenic
940541079 2:155019049-155019071 GTGTAGAATTTTGGGTTGATAGG + Intergenic
941216687 2:162718996-162719018 GAATAAAATTATCAGTGGATTGG - Intronic
942534945 2:176952997-176953019 GAATAGAATCAGCATTTGATTGG - Intergenic
1172187198 20:33038390-33038412 GAGTAGAATGATAAATGGATGGG - Intronic
1175351735 20:58326679-58326701 GAGTAGAATTGATAGTTGGTAGG + Intronic
1179004432 21:37498698-37498720 GAGTAGAATTGCCAGGTCATGGG + Intronic
1180358359 22:11861025-11861047 TAGTATAATTATCAGGTGAGAGG + Intergenic
1180379903 22:12131305-12131327 TAGTATAATTATCAGGTGAGAGG - Intergenic
1182458453 22:30467974-30467996 GAATAGAATTCTTGGTTGATGGG - Intronic
954726381 3:52614452-52614474 GAGTATCATTATCAATTGCTTGG + Intronic
956499099 3:69862431-69862453 GAGTAGAAGTATGAGTTTACTGG + Intronic
959551482 3:107664229-107664251 GAGTTGAATTGTTAGGTGATAGG + Intronic
961092907 3:124130597-124130619 GTGTAGAATTATGGGTTCATGGG - Intronic
961529864 3:127533857-127533879 GAGTAGTGTTGTCAGGTGATGGG - Intergenic
963766538 3:149342309-149342331 CAGTAGAATTCTTATTTGATAGG - Intergenic
966281024 3:178229239-178229261 ATGTAGGATTATCAGTTGACAGG + Intergenic
967558375 3:190887608-190887630 AAGTTGAATTAGAAGTTGATGGG - Intronic
968250617 3:197208378-197208400 AAGTAGAATTATCAGGTCAGAGG - Intronic
970161302 4:13192234-13192256 GAGTTGAATGATCAATTGGTAGG + Intergenic
971921763 4:32949586-32949608 GTGTACACTTATCAGGTGATGGG + Intergenic
972469487 4:39390001-39390023 GGGAAAAATTAGCAGTTGATAGG - Intergenic
973057132 4:45674595-45674617 GAGTAAAATTCCAAGTTGATAGG + Intergenic
973072687 4:45884407-45884429 GAGGAGAATGATGAGATGATGGG + Intergenic
976114187 4:81709537-81709559 TAGAAGAATTATCAGTATATTGG + Intronic
976222171 4:82765257-82765279 ATATAGAATTCTCAGTTGATAGG + Intronic
976554780 4:86437711-86437733 GAGTAGAATTGTGAGATTATAGG - Intronic
981979010 4:150769243-150769265 GCATAGAAATAGCAGTTGATAGG - Intronic
982656392 4:158154904-158154926 GTGTACACTGATCAGTTGATGGG + Intronic
985306743 4:188550994-188551016 GAGAAGAATAATCAGTTTTTGGG + Intergenic
988333045 5:29867791-29867813 GAATAGACATATTAGTTGATAGG + Intergenic
990440639 5:55841652-55841674 GAGTGGAGCTATCAGGTGATGGG - Intergenic
992141164 5:73798576-73798598 GGGGAGAATCATCAGTTGAAGGG + Intronic
992281834 5:75185953-75185975 GAGAAGAATTATCAGTTTCAGGG + Intronic
993785498 5:92129569-92129591 GAGTAGAATTGTCAGATCCTCGG + Intergenic
994925872 5:106116190-106116212 GAGGAGAAATATCATTTGTTAGG + Intergenic
995673062 5:114629351-114629373 GAGTAGAATTATTAGATCATAGG - Intergenic
996670808 5:126114766-126114788 GAAAAGAATTATCTGTTTATAGG - Intergenic
1004813197 6:19282508-19282530 GAGCAGAAGTATAAGCTGATGGG - Intergenic
1011617884 6:89213665-89213687 CAATAGAATTATCATTTGATTGG - Intronic
1011985062 6:93433083-93433105 GAATGGATTTATCAGTTAATAGG + Intergenic
1013469055 6:110445040-110445062 GAGTATTATTATCAGTGGAAGGG - Intronic
1014484995 6:121987472-121987494 GAGTGGAATTGTCATTTCATAGG + Intergenic
1014653341 6:124068939-124068961 GAGTAGAATCCTTAGCTGATTGG + Intronic
1021448769 7:20761548-20761570 AAGTGGAATTATAAATTGATTGG + Intronic
1024433139 7:49314374-49314396 AATTTGAATTTTCAGTTGATAGG - Intergenic
1024636290 7:51293061-51293083 GATGAGAATTAACAGTTGTTGGG - Intronic
1030647386 7:112077836-112077858 CAGTAAACTTATCAGTTAATAGG + Intronic
1030656773 7:112177027-112177049 GACTAGAATTAGAAGTTGGTTGG - Intronic
1031601610 7:123716942-123716964 GTATAGAATTAGCAGCTGATTGG - Intronic
1031603022 7:123736147-123736169 GTATAAAATTATAAGTTGATAGG - Intronic
1035563450 8:626273-626295 GAGTAGAATTGTCAGAGAATGGG - Intronic
1036528601 8:9558929-9558951 GAAAAAAATTATCAGTTGACTGG + Intronic
1036593706 8:10193085-10193107 GAGGAGAATTATGTCTTGATAGG - Intronic
1036828237 8:11996559-11996581 GAGTAAAATTAAAATTTGATAGG + Intergenic
1037486814 8:19355871-19355893 GACCAGTTTTATCAGTTGATAGG + Intronic
1039874452 8:41573776-41573798 GAGTAGAATTACCATACGATTGG + Intergenic
1040766222 8:50914421-50914443 GGGTAAATTTATCAGTTCATTGG - Intergenic
1041279082 8:56193578-56193600 GAGTAGAATTATCAGTTGATTGG - Intronic
1044161759 8:88926754-88926776 AATTATAATTATCAGTAGATGGG + Intergenic
1047888062 8:129274845-129274867 AAGGAGAATTGGCAGTTGATTGG + Intergenic
1050199912 9:3133200-3133222 GAGGAGAAGTCTCAGCTGATTGG + Intergenic
1050704698 9:8383901-8383923 GATTAGTATTAGCAGTTGAAAGG - Intronic
1051834155 9:21316274-21316296 GAGTAGAATTAACAGTAACTGGG - Intergenic
1053262836 9:36685395-36685417 GGGTAGAATTATCAGATTTTAGG + Intergenic
1054778365 9:69142707-69142729 AAGTAGAAATATTAGTTGAAAGG + Intronic
1055098751 9:72441392-72441414 GAGCTGCATTATCAGTAGATGGG + Intergenic
1185783786 X:2872109-2872131 GAGAAGAATTCTCAGGTCATTGG - Intronic
1186719096 X:12283399-12283421 GAGTATACTCATCAGTTTATTGG - Intronic
1187725060 X:22193791-22193813 GAGTGGAATTATTGGCTGATAGG + Intronic
1189122102 X:38405712-38405734 GAGGAGAATTATCTGTTGTAAGG - Intronic
1192137068 X:68612850-68612872 GATTAGAATAATCAGTTGCCCGG + Intergenic
1198654203 X:138895970-138895992 GAGAAGAATTATCAGAGGTTGGG + Intronic
1199511476 X:148627584-148627606 CAGTAGCAATATCAATTGATAGG + Intronic