ID: 1041283073

View in Genome Browser
Species Human (GRCh38)
Location 8:56231132-56231154
Sequence CAGTTTCAGAATATGCCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041283073_1041283075 -8 Left 1041283073 8:56231132-56231154 CCTCATGGCATATTCTGAAACTG No data
Right 1041283075 8:56231147-56231169 TGAAACTGTCCCTCCTAAAAGGG No data
1041283073_1041283080 14 Left 1041283073 8:56231132-56231154 CCTCATGGCATATTCTGAAACTG No data
Right 1041283080 8:56231169-56231191 GAGCTGAATTCAGGCCCCAGTGG No data
1041283073_1041283074 -9 Left 1041283073 8:56231132-56231154 CCTCATGGCATATTCTGAAACTG No data
Right 1041283074 8:56231146-56231168 CTGAAACTGTCCCTCCTAAAAGG No data
1041283073_1041283079 5 Left 1041283073 8:56231132-56231154 CCTCATGGCATATTCTGAAACTG No data
Right 1041283079 8:56231160-56231182 CCTAAAAGGGAGCTGAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041283073 Original CRISPR CAGTTTCAGAATATGCCATG AGG (reversed) Intergenic
No off target data available for this crispr