ID: 1041289760

View in Genome Browser
Species Human (GRCh38)
Location 8:56297570-56297592
Sequence GCAAATGCACAGAAGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041289757_1041289760 -10 Left 1041289757 8:56297557-56297579 CCTGCATAGCCGAGCAAATGCAC No data
Right 1041289760 8:56297570-56297592 GCAAATGCACAGAAGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041289760 Original CRISPR GCAAATGCACAGAAGGAGCT TGG Intergenic
No off target data available for this crispr