ID: 1041291305

View in Genome Browser
Species Human (GRCh38)
Location 8:56310857-56310879
Sequence CAGTAGTTCTTGTAGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041291303_1041291305 15 Left 1041291303 8:56310819-56310841 CCAAGGAGAGGGACATTTGGGAC 0: 1
1: 0
2: 1
3: 17
4: 175
Right 1041291305 8:56310857-56310879 CAGTAGTTCTTGTAGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041291305 Original CRISPR CAGTAGTTCTTGTAGGAACA TGG Intronic
No off target data available for this crispr