ID: 1041295570

View in Genome Browser
Species Human (GRCh38)
Location 8:56353869-56353891
Sequence TCTCTGAATAGACCAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041295570_1041295572 4 Left 1041295570 8:56353869-56353891 CCTGCTTTTGGTCTATTCAGAGA No data
Right 1041295572 8:56353896-56353918 ACTTCTTCCTGGTTTAGTCTTGG 0: 7845
1: 4044
2: 2111
3: 1994
4: 3017
1041295570_1041295573 5 Left 1041295570 8:56353869-56353891 CCTGCTTTTGGTCTATTCAGAGA No data
Right 1041295573 8:56353897-56353919 CTTCTTCCTGGTTTAGTCTTGGG 0: 8208
1: 3830
2: 1865
3: 1367
4: 1454
1041295570_1041295574 8 Left 1041295570 8:56353869-56353891 CCTGCTTTTGGTCTATTCAGAGA No data
Right 1041295574 8:56353900-56353922 CTTCCTGGTTTAGTCTTGGGAGG 0: 4909
1: 3354
2: 2054
3: 1804
4: 2205
1041295570_1041295575 9 Left 1041295570 8:56353869-56353891 CCTGCTTTTGGTCTATTCAGAGA No data
Right 1041295575 8:56353901-56353923 TTCCTGGTTTAGTCTTGGGAGGG 0: 4718
1: 3187
2: 1764
3: 861
4: 576
1041295570_1041295577 23 Left 1041295570 8:56353869-56353891 CCTGCTTTTGGTCTATTCAGAGA No data
Right 1041295577 8:56353915-56353937 TTGGGAGGGTGTATGTGTCGAGG 0: 1234
1: 6061
2: 4709
3: 2628
4: 2338
1041295570_1041295571 -7 Left 1041295570 8:56353869-56353891 CCTGCTTTTGGTCTATTCAGAGA No data
Right 1041295571 8:56353885-56353907 TCAGAGATTCAACTTCTTCCTGG 0: 5800
1: 3527
2: 2396
3: 2146
4: 1885

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041295570 Original CRISPR TCTCTGAATAGACCAAAAGC AGG (reversed) Intergenic
No off target data available for this crispr