ID: 1041300355

View in Genome Browser
Species Human (GRCh38)
Location 8:56405049-56405071
Sequence TATTCTGGTGCAGCACTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041300350_1041300355 22 Left 1041300350 8:56405004-56405026 CCTTACAGCTCTCTGTCCAGGCC No data
Right 1041300355 8:56405049-56405071 TATTCTGGTGCAGCACTCCCAGG No data
1041300353_1041300355 -3 Left 1041300353 8:56405029-56405051 CCTCAAGTCTCTGCTTCATATAT No data
Right 1041300355 8:56405049-56405071 TATTCTGGTGCAGCACTCCCAGG No data
1041300351_1041300355 6 Left 1041300351 8:56405020-56405042 CCAGGCCTGCCTCAAGTCTCTGC No data
Right 1041300355 8:56405049-56405071 TATTCTGGTGCAGCACTCCCAGG No data
1041300352_1041300355 1 Left 1041300352 8:56405025-56405047 CCTGCCTCAAGTCTCTGCTTCAT No data
Right 1041300355 8:56405049-56405071 TATTCTGGTGCAGCACTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041300355 Original CRISPR TATTCTGGTGCAGCACTCCC AGG Intergenic
No off target data available for this crispr