ID: 1041300358

View in Genome Browser
Species Human (GRCh38)
Location 8:56405074-56405096
Sequence GCCCCAGCTGTGTCTCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041300352_1041300358 26 Left 1041300352 8:56405025-56405047 CCTGCCTCAAGTCTCTGCTTCAT No data
Right 1041300358 8:56405074-56405096 GCCCCAGCTGTGTCTCAAGCAGG No data
1041300353_1041300358 22 Left 1041300353 8:56405029-56405051 CCTCAAGTCTCTGCTTCATATAT No data
Right 1041300358 8:56405074-56405096 GCCCCAGCTGTGTCTCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041300358 Original CRISPR GCCCCAGCTGTGTCTCAAGC AGG Intergenic
No off target data available for this crispr