ID: 1041306011

View in Genome Browser
Species Human (GRCh38)
Location 8:56461735-56461757
Sequence CTGTGAAAGTAGAAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041306011_1041306015 11 Left 1041306011 8:56461735-56461757 CCCACTTCCTTCTACTTTCACAG No data
Right 1041306015 8:56461769-56461791 AAATCCACTGATAGTCTATAGGG No data
1041306011_1041306016 12 Left 1041306011 8:56461735-56461757 CCCACTTCCTTCTACTTTCACAG No data
Right 1041306016 8:56461770-56461792 AATCCACTGATAGTCTATAGGGG No data
1041306011_1041306014 10 Left 1041306011 8:56461735-56461757 CCCACTTCCTTCTACTTTCACAG No data
Right 1041306014 8:56461768-56461790 GAAATCCACTGATAGTCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041306011 Original CRISPR CTGTGAAAGTAGAAGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr