ID: 1041307161

View in Genome Browser
Species Human (GRCh38)
Location 8:56473235-56473257
Sequence TTGGATGCACAGATGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041307153_1041307161 19 Left 1041307153 8:56473193-56473215 CCAGCTTATTTTGGGAATAAGAA No data
Right 1041307161 8:56473235-56473257 TTGGATGCACAGATGGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041307161 Original CRISPR TTGGATGCACAGATGGAGGC CGG Intergenic
No off target data available for this crispr