ID: 1041308181

View in Genome Browser
Species Human (GRCh38)
Location 8:56485341-56485363
Sequence TGTAGCCAAAAGACCAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041308177_1041308181 14 Left 1041308177 8:56485304-56485326 CCCCAAGAAAAACTCCAAGAAAA No data
Right 1041308181 8:56485341-56485363 TGTAGCCAAAAGACCAAGAAAGG No data
1041308180_1041308181 0 Left 1041308180 8:56485318-56485340 CCAAGAAAAAAAAGCTTGTTCTT No data
Right 1041308181 8:56485341-56485363 TGTAGCCAAAAGACCAAGAAAGG No data
1041308172_1041308181 28 Left 1041308172 8:56485290-56485312 CCCACCACCCAACTCCCCAAGAA No data
Right 1041308181 8:56485341-56485363 TGTAGCCAAAAGACCAAGAAAGG No data
1041308171_1041308181 29 Left 1041308171 8:56485289-56485311 CCCCACCACCCAACTCCCCAAGA No data
Right 1041308181 8:56485341-56485363 TGTAGCCAAAAGACCAAGAAAGG No data
1041308174_1041308181 24 Left 1041308174 8:56485294-56485316 CCACCCAACTCCCCAAGAAAAAC No data
Right 1041308181 8:56485341-56485363 TGTAGCCAAAAGACCAAGAAAGG No data
1041308178_1041308181 13 Left 1041308178 8:56485305-56485327 CCCAAGAAAAACTCCAAGAAAAA No data
Right 1041308181 8:56485341-56485363 TGTAGCCAAAAGACCAAGAAAGG No data
1041308175_1041308181 21 Left 1041308175 8:56485297-56485319 CCCAACTCCCCAAGAAAAACTCC No data
Right 1041308181 8:56485341-56485363 TGTAGCCAAAAGACCAAGAAAGG No data
1041308173_1041308181 27 Left 1041308173 8:56485291-56485313 CCACCACCCAACTCCCCAAGAAA No data
Right 1041308181 8:56485341-56485363 TGTAGCCAAAAGACCAAGAAAGG No data
1041308176_1041308181 20 Left 1041308176 8:56485298-56485320 CCAACTCCCCAAGAAAAACTCCA No data
Right 1041308181 8:56485341-56485363 TGTAGCCAAAAGACCAAGAAAGG No data
1041308179_1041308181 12 Left 1041308179 8:56485306-56485328 CCAAGAAAAACTCCAAGAAAAAA No data
Right 1041308181 8:56485341-56485363 TGTAGCCAAAAGACCAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041308181 Original CRISPR TGTAGCCAAAAGACCAAGAA AGG Intergenic
No off target data available for this crispr