ID: 1041309733

View in Genome Browser
Species Human (GRCh38)
Location 8:56503162-56503184
Sequence CAGGGAAAGGAGATGGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041309726_1041309733 26 Left 1041309726 8:56503113-56503135 CCAGGACATGCTGATAACATTAG No data
Right 1041309733 8:56503162-56503184 CAGGGAAAGGAGATGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041309733 Original CRISPR CAGGGAAAGGAGATGGGGTC TGG Intergenic
No off target data available for this crispr