ID: 1041313099

View in Genome Browser
Species Human (GRCh38)
Location 8:56536277-56536299
Sequence CAGAATCAACCATCTGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041313099_1041313101 1 Left 1041313099 8:56536277-56536299 CCTGGGGCAGATGGTTGATTCTG No data
Right 1041313101 8:56536301-56536323 GTGCAATCTTCTAAATGGTGTGG No data
1041313099_1041313103 3 Left 1041313099 8:56536277-56536299 CCTGGGGCAGATGGTTGATTCTG No data
Right 1041313103 8:56536303-56536325 GCAATCTTCTAAATGGTGTGGGG No data
1041313099_1041313102 2 Left 1041313099 8:56536277-56536299 CCTGGGGCAGATGGTTGATTCTG No data
Right 1041313102 8:56536302-56536324 TGCAATCTTCTAAATGGTGTGGG No data
1041313099_1041313104 17 Left 1041313099 8:56536277-56536299 CCTGGGGCAGATGGTTGATTCTG No data
Right 1041313104 8:56536317-56536339 GGTGTGGGGTTTGCCAAACATGG No data
1041313099_1041313100 -4 Left 1041313099 8:56536277-56536299 CCTGGGGCAGATGGTTGATTCTG No data
Right 1041313100 8:56536296-56536318 TCTGTGTGCAATCTTCTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041313099 Original CRISPR CAGAATCAACCATCTGCCCC AGG (reversed) Intergenic
No off target data available for this crispr