ID: 1041313102

View in Genome Browser
Species Human (GRCh38)
Location 8:56536302-56536324
Sequence TGCAATCTTCTAAATGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041313099_1041313102 2 Left 1041313099 8:56536277-56536299 CCTGGGGCAGATGGTTGATTCTG No data
Right 1041313102 8:56536302-56536324 TGCAATCTTCTAAATGGTGTGGG No data
1041313097_1041313102 17 Left 1041313097 8:56536262-56536284 CCTAGAAGTTTCTTGCCTGGGGC No data
Right 1041313102 8:56536302-56536324 TGCAATCTTCTAAATGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041313102 Original CRISPR TGCAATCTTCTAAATGGTGT GGG Intergenic
No off target data available for this crispr