ID: 1041326303

View in Genome Browser
Species Human (GRCh38)
Location 8:56669802-56669824
Sequence CAGACTCAAATACCTAGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041326303_1041326306 13 Left 1041326303 8:56669802-56669824 CCAATTCTAGGTATTTGAGTCTG No data
Right 1041326306 8:56669838-56669860 GCTAGCCCTAGTACTAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041326303 Original CRISPR CAGACTCAAATACCTAGAAT TGG (reversed) Intergenic
No off target data available for this crispr