ID: 1041327244

View in Genome Browser
Species Human (GRCh38)
Location 8:56681573-56681595
Sequence GAAAGCACGGAGAGGGCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041327235_1041327244 23 Left 1041327235 8:56681527-56681549 CCCTGTCCTACTCCCACTGTGCC No data
Right 1041327244 8:56681573-56681595 GAAAGCACGGAGAGGGCGCCAGG No data
1041327239_1041327244 10 Left 1041327239 8:56681540-56681562 CCACTGTGCCTACAGAGCAGACT No data
Right 1041327244 8:56681573-56681595 GAAAGCACGGAGAGGGCGCCAGG No data
1041327238_1041327244 11 Left 1041327238 8:56681539-56681561 CCCACTGTGCCTACAGAGCAGAC No data
Right 1041327244 8:56681573-56681595 GAAAGCACGGAGAGGGCGCCAGG No data
1041327236_1041327244 22 Left 1041327236 8:56681528-56681550 CCTGTCCTACTCCCACTGTGCCT No data
Right 1041327244 8:56681573-56681595 GAAAGCACGGAGAGGGCGCCAGG No data
1041327240_1041327244 2 Left 1041327240 8:56681548-56681570 CCTACAGAGCAGACTGATATATT No data
Right 1041327244 8:56681573-56681595 GAAAGCACGGAGAGGGCGCCAGG No data
1041327237_1041327244 17 Left 1041327237 8:56681533-56681555 CCTACTCCCACTGTGCCTACAGA No data
Right 1041327244 8:56681573-56681595 GAAAGCACGGAGAGGGCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041327244 Original CRISPR GAAAGCACGGAGAGGGCGCC AGG Intergenic
No off target data available for this crispr