ID: 1041328467

View in Genome Browser
Species Human (GRCh38)
Location 8:56696202-56696224
Sequence ATAGAGAGGTGAAGCACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041328467_1041328472 5 Left 1041328467 8:56696202-56696224 CCATTTGTGCTTCACCTCTCTAT No data
Right 1041328472 8:56696230-56696252 TGCCGAGGCAGTCAATATAGGGG No data
1041328467_1041328471 4 Left 1041328467 8:56696202-56696224 CCATTTGTGCTTCACCTCTCTAT No data
Right 1041328471 8:56696229-56696251 TTGCCGAGGCAGTCAATATAGGG No data
1041328467_1041328474 26 Left 1041328467 8:56696202-56696224 CCATTTGTGCTTCACCTCTCTAT No data
Right 1041328474 8:56696251-56696273 GGCCCTGACTATATGTGAGATGG No data
1041328467_1041328470 3 Left 1041328467 8:56696202-56696224 CCATTTGTGCTTCACCTCTCTAT No data
Right 1041328470 8:56696228-56696250 CTTGCCGAGGCAGTCAATATAGG No data
1041328467_1041328468 -10 Left 1041328467 8:56696202-56696224 CCATTTGTGCTTCACCTCTCTAT No data
Right 1041328468 8:56696215-56696237 ACCTCTCTATACTCTTGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041328467 Original CRISPR ATAGAGAGGTGAAGCACAAA TGG (reversed) Intergenic
No off target data available for this crispr