ID: 1041328470

View in Genome Browser
Species Human (GRCh38)
Location 8:56696228-56696250
Sequence CTTGCCGAGGCAGTCAATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041328467_1041328470 3 Left 1041328467 8:56696202-56696224 CCATTTGTGCTTCACCTCTCTAT No data
Right 1041328470 8:56696228-56696250 CTTGCCGAGGCAGTCAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041328470 Original CRISPR CTTGCCGAGGCAGTCAATAT AGG Intergenic
No off target data available for this crispr