ID: 1041329122

View in Genome Browser
Species Human (GRCh38)
Location 8:56704599-56704621
Sequence TAGCCAGTATACTAAGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041329122_1041329126 -7 Left 1041329122 8:56704599-56704621 CCAAAATCTTAGTATACTGGCTA No data
Right 1041329126 8:56704615-56704637 CTGGCTAATTAGGCTTTGAGGGG No data
1041329122_1041329129 22 Left 1041329122 8:56704599-56704621 CCAAAATCTTAGTATACTGGCTA No data
Right 1041329129 8:56704644-56704666 CGGTGAAAAAGAAAAAGTAGAGG No data
1041329122_1041329128 2 Left 1041329122 8:56704599-56704621 CCAAAATCTTAGTATACTGGCTA No data
Right 1041329128 8:56704624-56704646 TAGGCTTTGAGGGGTGGAAACGG No data
1041329122_1041329124 -9 Left 1041329122 8:56704599-56704621 CCAAAATCTTAGTATACTGGCTA No data
Right 1041329124 8:56704613-56704635 TACTGGCTAATTAGGCTTTGAGG No data
1041329122_1041329127 -4 Left 1041329122 8:56704599-56704621 CCAAAATCTTAGTATACTGGCTA No data
Right 1041329127 8:56704618-56704640 GCTAATTAGGCTTTGAGGGGTGG No data
1041329122_1041329125 -8 Left 1041329122 8:56704599-56704621 CCAAAATCTTAGTATACTGGCTA No data
Right 1041329125 8:56704614-56704636 ACTGGCTAATTAGGCTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041329122 Original CRISPR TAGCCAGTATACTAAGATTT TGG (reversed) Intergenic
No off target data available for this crispr