ID: 1041329126

View in Genome Browser
Species Human (GRCh38)
Location 8:56704615-56704637
Sequence CTGGCTAATTAGGCTTTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041329122_1041329126 -7 Left 1041329122 8:56704599-56704621 CCAAAATCTTAGTATACTGGCTA No data
Right 1041329126 8:56704615-56704637 CTGGCTAATTAGGCTTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041329126 Original CRISPR CTGGCTAATTAGGCTTTGAG GGG Intergenic
No off target data available for this crispr