ID: 1041333835

View in Genome Browser
Species Human (GRCh38)
Location 8:56757671-56757693
Sequence CACAAAAAGGGGAAGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041333829_1041333835 20 Left 1041333829 8:56757628-56757650 CCTTATCAGGTGGCCTTATGGAA No data
Right 1041333835 8:56757671-56757693 CACAAAAAGGGGAAGGAGTCAGG No data
1041333827_1041333835 23 Left 1041333827 8:56757625-56757647 CCACCTTATCAGGTGGCCTTATG No data
Right 1041333835 8:56757671-56757693 CACAAAAAGGGGAAGGAGTCAGG No data
1041333826_1041333835 27 Left 1041333826 8:56757621-56757643 CCAGCCACCTTATCAGGTGGCCT No data
Right 1041333835 8:56757671-56757693 CACAAAAAGGGGAAGGAGTCAGG No data
1041333830_1041333835 7 Left 1041333830 8:56757641-56757663 CCTTATGGAAGCTCAAGATCACT No data
Right 1041333835 8:56757671-56757693 CACAAAAAGGGGAAGGAGTCAGG No data
1041333825_1041333835 28 Left 1041333825 8:56757620-56757642 CCCAGCCACCTTATCAGGTGGCC No data
Right 1041333835 8:56757671-56757693 CACAAAAAGGGGAAGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041333835 Original CRISPR CACAAAAAGGGGAAGGAGTC AGG Intergenic
No off target data available for this crispr