ID: 1041334934

View in Genome Browser
Species Human (GRCh38)
Location 8:56771545-56771567
Sequence AGAATGGCATCTAGAATTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041334931_1041334934 -4 Left 1041334931 8:56771526-56771548 CCAGAGCTTCAGTCCACAGAGAA No data
Right 1041334934 8:56771545-56771567 AGAATGGCATCTAGAATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041334934 Original CRISPR AGAATGGCATCTAGAATTCT AGG Intergenic
No off target data available for this crispr