ID: 1041336274

View in Genome Browser
Species Human (GRCh38)
Location 8:56788093-56788115
Sequence TCTCTTCTTTTGGGCGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041336269_1041336274 22 Left 1041336269 8:56788048-56788070 CCTGGCTGTATTAGGCCAAATGG No data
Right 1041336274 8:56788093-56788115 TCTCTTCTTTTGGGCGCCACAGG No data
1041336271_1041336274 7 Left 1041336271 8:56788063-56788085 CCAAATGGACAATTTTTTGAGAG No data
Right 1041336274 8:56788093-56788115 TCTCTTCTTTTGGGCGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041336274 Original CRISPR TCTCTTCTTTTGGGCGCCAC AGG Intergenic