ID: 1041345242

View in Genome Browser
Species Human (GRCh38)
Location 8:56890292-56890314
Sequence CAGAGCTTTCACGTGGGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041345242_1041345254 14 Left 1041345242 8:56890292-56890314 CCCGGTCCCACGTGAAAGCTCTG No data
Right 1041345254 8:56890329-56890351 TTGCTCCAATCCTAGGGGATGGG No data
1041345242_1041345250 7 Left 1041345242 8:56890292-56890314 CCCGGTCCCACGTGAAAGCTCTG No data
Right 1041345250 8:56890322-56890344 ACTCTGATTGCTCCAATCCTAGG No data
1041345242_1041345253 13 Left 1041345242 8:56890292-56890314 CCCGGTCCCACGTGAAAGCTCTG No data
Right 1041345253 8:56890328-56890350 ATTGCTCCAATCCTAGGGGATGG No data
1041345242_1041345259 27 Left 1041345242 8:56890292-56890314 CCCGGTCCCACGTGAAAGCTCTG No data
Right 1041345259 8:56890342-56890364 AGGGGATGGGGGTTGTGTTTTGG No data
1041345242_1041345256 16 Left 1041345242 8:56890292-56890314 CCCGGTCCCACGTGAAAGCTCTG No data
Right 1041345256 8:56890331-56890353 GCTCCAATCCTAGGGGATGGGGG No data
1041345242_1041345252 9 Left 1041345242 8:56890292-56890314 CCCGGTCCCACGTGAAAGCTCTG No data
Right 1041345252 8:56890324-56890346 TCTGATTGCTCCAATCCTAGGGG No data
1041345242_1041345260 28 Left 1041345242 8:56890292-56890314 CCCGGTCCCACGTGAAAGCTCTG No data
Right 1041345260 8:56890343-56890365 GGGGATGGGGGTTGTGTTTTGGG No data
1041345242_1041345255 15 Left 1041345242 8:56890292-56890314 CCCGGTCCCACGTGAAAGCTCTG No data
Right 1041345255 8:56890330-56890352 TGCTCCAATCCTAGGGGATGGGG No data
1041345242_1041345251 8 Left 1041345242 8:56890292-56890314 CCCGGTCCCACGTGAAAGCTCTG No data
Right 1041345251 8:56890323-56890345 CTCTGATTGCTCCAATCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041345242 Original CRISPR CAGAGCTTTCACGTGGGACC GGG (reversed) Intergenic
No off target data available for this crispr