ID: 1041345926

View in Genome Browser
Species Human (GRCh38)
Location 8:56898054-56898076
Sequence AGACTCATGGGGGATATAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041345926_1041345931 -9 Left 1041345926 8:56898054-56898076 CCAATTATATCCCCCATGAGTCT No data
Right 1041345931 8:56898068-56898090 CATGAGTCTCCTTCTGCTGCAGG No data
1041345926_1041345934 24 Left 1041345926 8:56898054-56898076 CCAATTATATCCCCCATGAGTCT No data
Right 1041345934 8:56898101-56898123 CCATTTTGTTCTTGCCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041345926 Original CRISPR AGACTCATGGGGGATATAAT TGG (reversed) Intergenic
No off target data available for this crispr