ID: 1041348791

View in Genome Browser
Species Human (GRCh38)
Location 8:56928781-56928803
Sequence GGGGCAGCCCAGTCCTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041348791_1041348800 18 Left 1041348791 8:56928781-56928803 CCAGAGAAGGACTGGGCTGCCCC No data
Right 1041348800 8:56928822-56928844 ATCTCTCACTCATTCTCACAGGG No data
1041348791_1041348799 17 Left 1041348791 8:56928781-56928803 CCAGAGAAGGACTGGGCTGCCCC No data
Right 1041348799 8:56928821-56928843 AATCTCTCACTCATTCTCACAGG No data
1041348791_1041348801 29 Left 1041348791 8:56928781-56928803 CCAGAGAAGGACTGGGCTGCCCC No data
Right 1041348801 8:56928833-56928855 ATTCTCACAGGGCCCTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041348791 Original CRISPR GGGGCAGCCCAGTCCTTCTC TGG (reversed) Intergenic