ID: 1041348794

View in Genome Browser
Species Human (GRCh38)
Location 8:56928800-56928822
Sequence TTTGGGCAGAAATGTCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041348794_1041348801 10 Left 1041348794 8:56928800-56928822 CCCCTGGGACATTTCTGCCCAAA No data
Right 1041348801 8:56928833-56928855 ATTCTCACAGGGCCCTTTTGTGG No data
1041348794_1041348799 -2 Left 1041348794 8:56928800-56928822 CCCCTGGGACATTTCTGCCCAAA No data
Right 1041348799 8:56928821-56928843 AATCTCTCACTCATTCTCACAGG No data
1041348794_1041348800 -1 Left 1041348794 8:56928800-56928822 CCCCTGGGACATTTCTGCCCAAA No data
Right 1041348800 8:56928822-56928844 ATCTCTCACTCATTCTCACAGGG No data
1041348794_1041348804 27 Left 1041348794 8:56928800-56928822 CCCCTGGGACATTTCTGCCCAAA No data
Right 1041348804 8:56928850-56928872 TTGTGGTTACACTTTGCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041348794 Original CRISPR TTTGGGCAGAAATGTCCCAG GGG (reversed) Intergenic