ID: 1041348796

View in Genome Browser
Species Human (GRCh38)
Location 8:56928802-56928824
Sequence GATTTGGGCAGAAATGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041348796_1041348800 -3 Left 1041348796 8:56928802-56928824 CCTGGGACATTTCTGCCCAAATC No data
Right 1041348800 8:56928822-56928844 ATCTCTCACTCATTCTCACAGGG No data
1041348796_1041348804 25 Left 1041348796 8:56928802-56928824 CCTGGGACATTTCTGCCCAAATC No data
Right 1041348804 8:56928850-56928872 TTGTGGTTACACTTTGCCTCCGG No data
1041348796_1041348801 8 Left 1041348796 8:56928802-56928824 CCTGGGACATTTCTGCCCAAATC No data
Right 1041348801 8:56928833-56928855 ATTCTCACAGGGCCCTTTTGTGG No data
1041348796_1041348799 -4 Left 1041348796 8:56928802-56928824 CCTGGGACATTTCTGCCCAAATC No data
Right 1041348799 8:56928821-56928843 AATCTCTCACTCATTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041348796 Original CRISPR GATTTGGGCAGAAATGTCCC AGG (reversed) Intergenic