ID: 1041348799

View in Genome Browser
Species Human (GRCh38)
Location 8:56928821-56928843
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041348795_1041348799 -3 Left 1041348795 8:56928801-56928823 CCCTGGGACATTTCTGCCCAAAT No data
Right 1041348799 8:56928821-56928843 AATCTCTCACTCATTCTCACAGG No data
1041348796_1041348799 -4 Left 1041348796 8:56928802-56928824 CCTGGGACATTTCTGCCCAAATC No data
Right 1041348799 8:56928821-56928843 AATCTCTCACTCATTCTCACAGG No data
1041348791_1041348799 17 Left 1041348791 8:56928781-56928803 CCAGAGAAGGACTGGGCTGCCCC No data
Right 1041348799 8:56928821-56928843 AATCTCTCACTCATTCTCACAGG No data
1041348790_1041348799 18 Left 1041348790 8:56928780-56928802 CCCAGAGAAGGACTGGGCTGCCC No data
Right 1041348799 8:56928821-56928843 AATCTCTCACTCATTCTCACAGG No data
1041348794_1041348799 -2 Left 1041348794 8:56928800-56928822 CCCCTGGGACATTTCTGCCCAAA No data
Right 1041348799 8:56928821-56928843 AATCTCTCACTCATTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041348799 Original CRISPR AATCTCTCACTCATTCTCAC AGG Intergenic