ID: 1041348801

View in Genome Browser
Species Human (GRCh38)
Location 8:56928833-56928855
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041348794_1041348801 10 Left 1041348794 8:56928800-56928822 CCCCTGGGACATTTCTGCCCAAA No data
Right 1041348801 8:56928833-56928855 ATTCTCACAGGGCCCTTTTGTGG No data
1041348790_1041348801 30 Left 1041348790 8:56928780-56928802 CCCAGAGAAGGACTGGGCTGCCC No data
Right 1041348801 8:56928833-56928855 ATTCTCACAGGGCCCTTTTGTGG No data
1041348798_1041348801 -8 Left 1041348798 8:56928818-56928840 CCAAATCTCTCACTCATTCTCAC No data
Right 1041348801 8:56928833-56928855 ATTCTCACAGGGCCCTTTTGTGG No data
1041348797_1041348801 -7 Left 1041348797 8:56928817-56928839 CCCAAATCTCTCACTCATTCTCA No data
Right 1041348801 8:56928833-56928855 ATTCTCACAGGGCCCTTTTGTGG No data
1041348796_1041348801 8 Left 1041348796 8:56928802-56928824 CCTGGGACATTTCTGCCCAAATC No data
Right 1041348801 8:56928833-56928855 ATTCTCACAGGGCCCTTTTGTGG No data
1041348791_1041348801 29 Left 1041348791 8:56928781-56928803 CCAGAGAAGGACTGGGCTGCCCC No data
Right 1041348801 8:56928833-56928855 ATTCTCACAGGGCCCTTTTGTGG No data
1041348795_1041348801 9 Left 1041348795 8:56928801-56928823 CCCTGGGACATTTCTGCCCAAAT No data
Right 1041348801 8:56928833-56928855 ATTCTCACAGGGCCCTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041348801 Original CRISPR ATTCTCACAGGGCCCTTTTG TGG Intergenic