ID: 1041348804

View in Genome Browser
Species Human (GRCh38)
Location 8:56928850-56928872
Sequence TTGTGGTTACACTTTGCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041348798_1041348804 9 Left 1041348798 8:56928818-56928840 CCAAATCTCTCACTCATTCTCAC No data
Right 1041348804 8:56928850-56928872 TTGTGGTTACACTTTGCCTCCGG No data
1041348797_1041348804 10 Left 1041348797 8:56928817-56928839 CCCAAATCTCTCACTCATTCTCA No data
Right 1041348804 8:56928850-56928872 TTGTGGTTACACTTTGCCTCCGG No data
1041348795_1041348804 26 Left 1041348795 8:56928801-56928823 CCCTGGGACATTTCTGCCCAAAT No data
Right 1041348804 8:56928850-56928872 TTGTGGTTACACTTTGCCTCCGG No data
1041348794_1041348804 27 Left 1041348794 8:56928800-56928822 CCCCTGGGACATTTCTGCCCAAA No data
Right 1041348804 8:56928850-56928872 TTGTGGTTACACTTTGCCTCCGG No data
1041348796_1041348804 25 Left 1041348796 8:56928802-56928824 CCTGGGACATTTCTGCCCAAATC No data
Right 1041348804 8:56928850-56928872 TTGTGGTTACACTTTGCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041348804 Original CRISPR TTGTGGTTACACTTTGCCTC CGG Intergenic
No off target data available for this crispr