ID: 1041352513

View in Genome Browser
Species Human (GRCh38)
Location 8:56962188-56962210
Sequence GCAACTGGTCAAATTCGAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041352513 Original CRISPR GCAACTGGTCAAATTCGAGA AGG (reversed) Exonic
913275055 1:117129020-117129042 GCAACTCTTCAACTTTGAGAAGG + Intergenic
914253836 1:145944641-145944663 ATAACTGCTCAAATTCAAGATGG - Intronic
915825998 1:159077484-159077506 GCAACTGGTTAAAGCCAAGATGG - Intronic
1064758652 10:18595996-18596018 GCAAATTGTAAAATTCAAGACGG + Intronic
1074377965 10:112953662-112953684 ACAACTGCTCAAGTTTGAGAAGG - Intronic
1081064781 11:38527651-38527673 GAAACTGTACAAATTCTAGAAGG + Intergenic
1087847576 11:102990818-102990840 CCCACTGGTCAAAGTGGAGAGGG + Intergenic
1088170969 11:106996213-106996235 GGAAGTGGTAAAATTAGAGATGG + Intronic
1096266738 12:50129374-50129396 GCAATTGTTCAAATTTCAGAAGG + Intronic
1098136826 12:67412058-67412080 GCAAATAGGCAAAATCGAGATGG + Intergenic
1098718623 12:73865640-73865662 GAAACGGGTCAAATAAGAGATGG - Intergenic
1106576855 13:30982699-30982721 GCAAATGATCAAACTCAAGAAGG - Intergenic
1113897210 13:113772914-113772936 TCAACTGGTCAATTTCTACAAGG + Intronic
1132279059 15:100596795-100596817 GCAATTGGTTAAATCCAAGATGG + Intronic
1134765232 16:16751617-16751639 GCAACTTGTCACATTCAATAAGG - Intergenic
1134980822 16:18607594-18607616 GCAACTTGTCACATTCAATAAGG + Intergenic
1141739377 16:85880615-85880637 GGATCTGCTCAAATTCCAGATGG - Intergenic
1143987965 17:10931472-10931494 GGGACTGGACAAATTCGAGAAGG + Intergenic
1144087737 17:11826037-11826059 GAAACTGGTTAAATCCAAGATGG - Intronic
1168659364 19:58154450-58154472 GCAACTGGACAAAGGCCAGAGGG - Intronic
925279633 2:2674118-2674140 CCAACTGGTGAAATTTGAGGAGG - Intergenic
933217895 2:79651409-79651431 CAACCTGGTCAAATTAGAGATGG - Intronic
933791061 2:85883966-85883988 GCTACTGGTGAAATTGGCGAGGG - Intronic
941403413 2:165059728-165059750 GAAACTGGTGAAATTCTAAAAGG - Intergenic
943834290 2:192499733-192499755 GCAACTGGGAATATTTGAGATGG - Intergenic
944478957 2:200135654-200135676 GCAAATTATCAAATTTGAGAAGG - Intergenic
944772028 2:202924557-202924579 TGAACTGGACAGATTCGAGATGG - Intronic
1170825913 20:19795399-19795421 GCTACTGGTCAACTTCCAAAGGG - Intergenic
1173233315 20:41219874-41219896 GCAACTGGTTATGTTCCAGATGG + Intronic
1180759314 22:18187552-18187574 GCAACTGGCCAAAGTCTATAAGG - Intergenic
1180769622 22:18371848-18371870 GCAACTGGCCAAAGTCTATAAGG - Intergenic
1180776706 22:18490818-18490840 GCAACTGGCCAAAGTCTATAAGG + Intergenic
1180809433 22:18748184-18748206 GCAACTGGCCAAAGTCTATAAGG + Intergenic
1180827562 22:18874811-18874833 GCAACTGGCCAAAGTCTATAAGG - Intergenic
1181072354 22:20353170-20353192 GCAACTGGCCAAAGTCTATAAGG + Intronic
1181195425 22:21182104-21182126 GCAACTGGCCAAAGTCTATAAGG + Intergenic
1181214022 22:21310670-21310692 GCAACTGGCCAAAGTCTATAAGG - Intergenic
1181524468 22:23472303-23472325 GCAACTGGCCAAAGTCTATAAGG - Intergenic
1203231453 22_KI270731v1_random:113035-113057 GCAACTGGCCAAAGTCTATAAGG - Intergenic
1203277659 22_KI270734v1_random:100801-100823 GCAACTGGCCAAAGTCTATAAGG - Intergenic
963492069 3:146014998-146015020 GTAACTGGTGAAATTCAGGATGG - Intergenic
966305566 3:178530208-178530230 GCATGTGGTCAAATGGGAGAAGG - Intronic
971613683 4:28759730-28759752 GAAAATGGTCAAATTTGTGAAGG - Intergenic
979342452 4:119542455-119542477 GCAAATGGTCACATTGGAGGTGG - Exonic
979535389 4:121813894-121813916 GGAACTGCCCAAATTGGAGAGGG + Exonic
984385482 4:179051335-179051357 TCAAATGCTCAAATTCGAGCTGG + Intergenic
984947151 4:184978558-184978580 GCTACTTTTCAAATTGGAGATGG - Intergenic
985608427 5:871938-871960 GCAACTGGTCATATTCCAGGTGG - Intronic
987017551 5:13835927-13835949 GAAAATGGTCACATTCTAGAAGG + Intronic
998643454 5:144037798-144037820 ACAACTGGTTAAATCCAAGATGG + Intergenic
1004218884 6:13728160-13728182 GCAACTGGTAAAATTTGAATGGG - Intergenic
1004385716 6:15171243-15171265 ACACCTGGTCTATTTCGAGAAGG + Intergenic
1005121729 6:22397519-22397541 GCTACTGGTCACATTCGTCAAGG - Intergenic
1006113768 6:31764349-31764371 GCAACAGGTAAACTTCAAGAAGG + Exonic
1006575834 6:35044960-35044982 GCATCTGGTCAAGTTACAGAGGG + Intronic
1014014821 6:116518114-116518136 GCAAATGGTGAAATCTGAGAAGG + Exonic
1016425703 6:143933935-143933957 GCAACTGGCAGAATTTGAGAGGG - Intronic
1016566519 6:145461188-145461210 TCAACTGCTCAAATTAGACAGGG - Intergenic
1020332432 7:7033090-7033112 GCAGCTGGCAAAATTCGGGAGGG - Intergenic
1021183930 7:17540876-17540898 ACAACTGGTTAAATTTAAGATGG + Intergenic
1029937104 7:104437611-104437633 GCAAATGATCAAACTGGAGAAGG - Intronic
1031220485 7:118958700-118958722 GCAGCTGGTGAAATTTGGGAGGG - Intergenic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1038729819 8:30116762-30116784 GCAAATGGTCAAACCCAAGAAGG + Intronic
1039188708 8:34947250-34947272 ACAACTGGTAAAATTAGAGCTGG - Intergenic
1039239594 8:35541557-35541579 CCAACTGGGCAAGTTGGAGAAGG - Intronic
1041076738 8:54175993-54176015 GAAACAGGTCAAAATCAAGATGG + Intergenic
1041352513 8:56962188-56962210 GCAACTGGTCAAATTCGAGAAGG - Exonic
1044862582 8:96537332-96537354 GCAACAGTTCAAATTCCAGCGGG - Intronic
1048036474 8:130682166-130682188 GCAACTGGCAAAATTCCAGATGG + Intergenic
1048347261 8:133585649-133585671 GCAACTGGTAAAATCATAGAAGG + Intergenic
1049524223 8:143113113-143113135 GCTACTGGTAGAATTAGAGATGG - Intergenic
1049650729 8:143767603-143767625 AAAACTGGTGAAATTTGAGAAGG - Intergenic
1051156010 9:14146721-14146743 GCAGCTGGTGAACTTGGAGAGGG + Exonic
1052358257 9:27528407-27528429 GCAAAGGCTCAAATCCGAGAAGG - Intronic
1053325514 9:37144803-37144825 GTAACAGGTCAAATTAGAAATGG - Intronic
1055118796 9:72634737-72634759 GCAAATGGTCAAATCTGAGGAGG - Intronic
1055632766 9:78240331-78240353 GCAAATTGTCCAATTGGAGATGG + Exonic
1055916733 9:81409723-81409745 GCAAATGATCAAATTTGAGAAGG + Intergenic
1186102874 X:6175375-6175397 GGAACTGGTTAAATACTAGATGG - Intronic
1189702742 X:43728829-43728851 GAAACTGGGCAAATTCAAGTGGG - Intronic
1194479836 X:94407341-94407363 ACAACTGGTTAAATCCAAGATGG - Intergenic