ID: 1041352613

View in Genome Browser
Species Human (GRCh38)
Location 8:56963800-56963822
Sequence TGTCCTGTCTTTTCTAGATC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041352612_1041352613 1 Left 1041352612 8:56963776-56963798 CCTGTAATCAGTTATGCTCATTT 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1041352613 8:56963800-56963822 TGTCCTGTCTTTTCTAGATCTGG 0: 1
1: 0
2: 0
3: 23
4: 180
1041352611_1041352613 2 Left 1041352611 8:56963775-56963797 CCCTGTAATCAGTTATGCTCATT 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1041352613 8:56963800-56963822 TGTCCTGTCTTTTCTAGATCTGG 0: 1
1: 0
2: 0
3: 23
4: 180
1041352610_1041352613 26 Left 1041352610 8:56963751-56963773 CCATTTCAGCTGTGAAGAACTGT 0: 1
1: 0
2: 3
3: 24
4: 338
Right 1041352613 8:56963800-56963822 TGTCCTGTCTTTTCTAGATCTGG 0: 1
1: 0
2: 0
3: 23
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041352613 Original CRISPR TGTCCTGTCTTTTCTAGATC TGG Exonic
902365788 1:15973354-15973376 TGTCCTGTCTCTTATTGAGCTGG - Intronic
902743507 1:18457245-18457267 TGTCGTATTTTTTGTAGATCAGG + Intergenic
905246724 1:36620140-36620162 TGCCCTGTCTCTTCTCCATCGGG + Intergenic
906521990 1:46472798-46472820 TTGCCTGTCCTTTCCAGATCTGG + Intergenic
906847514 1:49209401-49209423 TGTACTGTGTTATCTATATCTGG - Intronic
907579571 1:55559455-55559477 TGTTCTGTCTTCTGAAGATCTGG - Intergenic
911233401 1:95384060-95384082 TTTCCTGTCTGTTCCAAATCTGG - Intergenic
911496136 1:98633672-98633694 TGTCCTTTCTTTTCAAAATCAGG - Intergenic
912572934 1:110637749-110637771 TGTCATGTATTTTCTGGTTCTGG + Intergenic
916673180 1:167043372-167043394 TGTTCTGTCTTTTCTCTAACTGG - Intergenic
917374524 1:174335126-174335148 TTTCTTTTCTTTTATAGATCAGG + Intronic
919016562 1:192045193-192045215 CTTCCTGTCTTTTCTTGCTCTGG + Intergenic
919411996 1:197257211-197257233 TTTCCTCTCTCTTCTTGATCTGG - Intergenic
919468776 1:197953222-197953244 TGTAATGTCTTTTCTATTTCTGG - Intergenic
920383513 1:205550047-205550069 TGTCCTGTCAGTTCTAAGTCTGG - Intergenic
921060505 1:211580045-211580067 TGTCCAGTCCTTTATAGATGGGG - Intergenic
922023592 1:221729535-221729557 TATCCTGACTTTTATAGCTCAGG - Intronic
923756081 1:236792393-236792415 TTTCTTGTCTCTTCTAGATTTGG + Intergenic
1065061906 10:21910800-21910822 TTTCCTTTCTTTTCTTGTTCTGG - Intronic
1065678540 10:28205138-28205160 TGTGCTGTCTTTTCTTGCTGTGG - Intronic
1067122053 10:43481448-43481470 TTTCCTGTCTCTTCTCCATCAGG - Exonic
1067563763 10:47322192-47322214 TGTGCTGTCCTTTCTATATTTGG + Intergenic
1067679289 10:48417919-48417941 TTTCCAGTCTTTTCTAGAGCAGG + Intronic
1067756506 10:49009780-49009802 TCTCCTGTCTTATCTCAATCTGG - Intergenic
1069643605 10:69974005-69974027 TTTCCTGTCTTTCCAAGATTTGG - Intergenic
1069918310 10:71800647-71800669 TGTGCTGTCTTCTCTGGACCGGG + Exonic
1071778228 10:88813238-88813260 TGTCTTGTGTTTTCGAGACCAGG - Exonic
1075122947 10:119677577-119677599 TGCACTGTCTTTTGTAGCTCTGG + Exonic
1076505743 10:130971564-130971586 TGTCCTGTGTTTCCTGGACCAGG + Intergenic
1078287381 11:9970822-9970844 TTCCCTGTCTTTGCTAGATATGG - Intronic
1079754544 11:24239861-24239883 TGTTCTGGCTTTTCTACTTCGGG + Intergenic
1079859403 11:25648315-25648337 TGGCTTGTCTTTGCTAGATTGGG + Intergenic
1083137029 11:60688714-60688736 TGCTCTGGCTTTTCTAGATCAGG - Intergenic
1084673131 11:70619336-70619358 TTTCCTGTCTCTTCCAGCTCTGG + Intronic
1085787554 11:79468252-79468274 TGATCTGTATTTTCTAAATCAGG + Intergenic
1086488132 11:87330549-87330571 TGTCCTGTCCTGTCTACTTCTGG - Intergenic
1087512273 11:99112385-99112407 TGTCCTGCCTTTTCTATTTATGG - Intronic
1087897538 11:103603451-103603473 CGTCCTGTGTTTTCCAGGTCTGG + Intergenic
1089338533 11:117742315-117742337 TGTCCTGTCATCACTAGATTGGG - Intronic
1090444607 11:126753127-126753149 TCTCCTGTCTTTCCTAGAGCAGG - Intronic
1090707334 11:129350608-129350630 TTTGCTGTCTTTTCTGGAGCCGG + Intergenic
1095446125 12:42284190-42284212 TGTCCCTTGTTCTCTAGATCTGG - Intronic
1096420068 12:51449416-51449438 TTTCCTTTCTTTTTTAGATAGGG - Intronic
1098967384 12:76805300-76805322 TTTTCTTTCTTTTCTAGATATGG + Exonic
1099731295 12:86507203-86507225 TTTTCTGTATTTTCTAGATGAGG - Intronic
1103332980 12:120167412-120167434 TGTACTGTGCTTTCTAGACCTGG - Intronic
1105329952 13:19406495-19406517 TGTTCTGTATTTTCTATTTCAGG + Intergenic
1105601367 13:21891576-21891598 TGTCTTCTCTTTTCTAGGTTTGG + Intergenic
1110214094 13:73006914-73006936 TGTGCTCTCTTTCCTAAATCTGG + Intronic
1110857907 13:80316958-80316980 TGTCCTGTCATTTTTATACCTGG - Intergenic
1111636108 13:90906311-90906333 TTTCCTGTCTTTTCTCTTTCTGG - Intergenic
1114513429 14:23281095-23281117 TGTCCTGTCCTTAGCAGATCAGG - Intronic
1115207337 14:30923499-30923521 TTTTCTGTCTTTTCTATATATGG - Intronic
1115266785 14:31508824-31508846 TGTCCTGGTTTGTCTGGATCTGG + Intronic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1118346021 14:64941521-64941543 TGTCTGGCCTTTTCTAGAGCAGG - Intronic
1118793617 14:69118779-69118801 TGTCATCTCCGTTCTAGATCAGG - Intronic
1120248753 14:82036658-82036680 AGTCCTGTCTTTTATAAATGGGG - Intergenic
1120418871 14:84256501-84256523 TGTCCTATTGTTTCTAGAGCAGG - Intergenic
1120537521 14:85715316-85715338 TGTTATCTCTTTTCTGGATCTGG + Intergenic
1126031972 15:44507948-44507970 TATCCTGTATTTTATAGATAGGG + Intronic
1128284193 15:66422731-66422753 TGCCCTGTGTTTTTTCGATCTGG + Intronic
1128983936 15:72205883-72205905 TGCCCTGTCTGTTCCAGCTCTGG - Intronic
1129512450 15:76134724-76134746 TGTCCTGGCCTATCTAGATATGG + Intronic
1130159661 15:81385888-81385910 TGACCCGTCTTTTGTAGAACAGG - Intergenic
1130853813 15:87823235-87823257 TGTCTTGTCTTTTCTTTTTCAGG + Intergenic
1131234076 15:90681387-90681409 TTTTCTGTCTTTTCCAGACCAGG + Intergenic
1134341408 16:13350163-13350185 TTTTCTGTCTCTTCTAGAGCTGG + Intergenic
1135231696 16:20714509-20714531 TGTCATTTCTTTCCTAGATTAGG - Intronic
1140351966 16:74271082-74271104 TGCCCTGAGTTTTCTAGATTGGG - Intergenic
1141301548 16:82820783-82820805 TGTCCTGGATTTCCTAGATCTGG + Intronic
1143161094 17:4871840-4871862 TGTCCATCCTTTTCTAGATGGGG + Intronic
1143308912 17:5972141-5972163 TCTCCTGTCTCTTCCAGCTCTGG + Intronic
1143374702 17:6460416-6460438 TGTCCTTCCTCCTCTAGATCAGG + Intronic
1143619848 17:8074502-8074524 AGTCCTGTCATTTCTAGCTCTGG + Intronic
1144245578 17:13360569-13360591 TGCTCTGTCCTTTCTACATCTGG - Intergenic
1144816788 17:18040226-18040248 TGACCTGTCGTCCCTAGATCAGG + Intronic
1147217475 17:38909019-38909041 TGGCCTGCCTTTTCCTGATCCGG - Intronic
1148877257 17:50697116-50697138 TCTCCTTTTTTTTCTAGAGCTGG - Exonic
1150833200 17:68541665-68541687 TGTGCTGTGTTTTCGTGATCTGG + Intronic
1151020250 17:70607529-70607551 AGTTCTGTCTTTTGTAGATGAGG + Intergenic
1151645892 17:75431342-75431364 TTCCCTGTCTTTTTTAGCTCTGG + Intergenic
1154062145 18:11071989-11072011 TGCCCTGTCCTTTCTGCATCAGG + Intronic
1155907820 18:31473839-31473861 TATCCTGTCTTTTCTATTTCTGG + Intronic
1156846900 18:41676531-41676553 TGTGCTGTCTTCTCTAGACTAGG + Intergenic
1158001885 18:52629095-52629117 TATTCTGTCTTTTCAAGAACTGG + Intronic
925290373 2:2744091-2744113 TGTCCTTTCTTTATTAAATCAGG - Intergenic
929855998 2:45639208-45639230 TCTCCTTCCTTTCCTAGATCAGG + Intergenic
931370117 2:61654533-61654555 TGTCCCTTCTTTTCTAAATCTGG - Intergenic
931961863 2:67491452-67491474 TGATCTGTGTTTTCTAGAACTGG - Intergenic
932325569 2:70858374-70858396 TGTTCTGGCTTTTCTAGTTAAGG + Intergenic
932372999 2:71208553-71208575 TGTTCTGTATTTTCTTGATTTGG + Intronic
937274691 2:120676138-120676160 TGCCCTGTCTTTTCTTTAACGGG - Intergenic
938959529 2:136328801-136328823 TTTCCTGTCTTTTCTTCATCTGG - Intergenic
939795717 2:146642065-146642087 TGTCCTGTTTTTTCCAGGTACGG - Intergenic
940011046 2:149055881-149055903 TGTGCTGTCTTTTCTAGCAAAGG - Intronic
940700920 2:157041793-157041815 CCTCCTGTCTTTTCTAGATGTGG + Intergenic
941932241 2:170953744-170953766 AGTCCTGTCCTTTCTACATCTGG - Intronic
942847240 2:180441924-180441946 TGTCCTTTAGTTTCTAGATCTGG + Intergenic
942909070 2:181219859-181219881 TTTCCTTTCTTTTCTAGACAGGG - Intergenic
948778208 2:240300949-240300971 TGCCCTGACTTTTCCAGCTCAGG + Intergenic
1169168716 20:3446453-3446475 TGTTCTCTTTTTTCTTGATCAGG - Intergenic
1169429251 20:5521914-5521936 TTCCCTGTCTCTGCTAGATCTGG + Intergenic
1172657925 20:36548307-36548329 TGGCCTGGCTTTTATAGTTCTGG - Intronic
1173026752 20:39314625-39314647 TGTCCTCTGTTTTCTTGTTCTGG + Intergenic
1173355496 20:42283812-42283834 TGTCATGTCTTCTCTACTTCTGG - Intronic
1174476355 20:50798604-50798626 TGTCCTGAGTTTTCAAAATCAGG + Intronic
1175126328 20:56754718-56754740 TTTTCTGTCTTTCCTAGAGCTGG + Intergenic
1175388894 20:58614136-58614158 TGTCCTTTCTTCCCTAGCTCAGG - Intergenic
950631150 3:14283043-14283065 TTTCCTGTCTTTTCTGGAGCTGG + Intergenic
951067943 3:18289585-18289607 TGTTTTGTTTTTTCTAAATCTGG + Intronic
951169082 3:19517850-19517872 TGTACTGTCTTTTAGGGATCAGG - Intronic
954947417 3:54438603-54438625 TGGCCTGTCTTTTGTAGCTAGGG + Intronic
956519356 3:70086634-70086656 TTTTCTGTCTCTTCTAGAACTGG + Intergenic
957326750 3:78705767-78705789 TGTGCTGTCTCTTCTGGAGCTGG + Intronic
960845669 3:122002374-122002396 TTTCCTGTCTTCTCTAAATTGGG + Intronic
961177487 3:124847794-124847816 TGTCAAATCTTTTCTAGTTCAGG + Intronic
961246953 3:125462767-125462789 TGTCCTGCATTATCTAGATCTGG - Intronic
961441669 3:126957237-126957259 CGTCCTCTCATTTCTAGAACGGG + Intronic
962526680 3:136243632-136243654 TGTCCTGTGATTTCCACATCAGG - Intergenic
963170242 3:142242979-142243001 TGTCCCTTCTTTTCTAGATTTGG + Intergenic
964517722 3:157531000-157531022 TGTTTTGTCTTTTCTGGATCTGG - Intronic
965384355 3:168027973-168027995 TGTCCTGGCTTTTCTGAATAAGG + Intronic
965394017 3:168140077-168140099 TTTCCTGTCTTTTGTATATTTGG - Intergenic
966988860 3:185208049-185208071 TGGGCTGTCATTTCTAGATTAGG + Intronic
968714884 4:2149375-2149397 TCCCCTGGCTTTTGTAGATCTGG - Intronic
970959852 4:21858917-21858939 TTTCCTGTGTTTTCTAAATTTGG - Intronic
973057270 4:45676570-45676592 TGTCCTGTGTATTCTTGATAGGG + Intergenic
974005960 4:56557577-56557599 TGTTTTGTGTTTTCTAAATCTGG + Intronic
975382824 4:73722190-73722212 TGTCGTGTCTTTAGGAGATCTGG + Intergenic
976944973 4:90753835-90753857 TTGCAAGTCTTTTCTAGATCTGG + Intronic
978547092 4:109882185-109882207 TCTCCTCTCTTTTCTAGATTGGG + Intergenic
979425363 4:120557872-120557894 TTTCCTGTCTTTTCTCAATCTGG - Intergenic
979939447 4:126741724-126741746 TGCCCTCTCTTTTCTACATTAGG - Intergenic
981709633 4:147696379-147696401 TGTCATGTCCTCTCTAGATCGGG + Intergenic
986647489 5:9931921-9931943 TGTATTGTCTTTTCTAAATTTGG + Intergenic
987141616 5:14952536-14952558 CTTCCTGTCTTTTGTGGATCTGG + Intergenic
989763663 5:45051497-45051519 TTTCTTGTCTCTTCTAGCTCTGG + Intergenic
990605455 5:57405297-57405319 TGTTCTGTATTTTCTAGTTTTGG - Intergenic
990751345 5:59020106-59020128 TGTCCATTTTTCTCTAGATCTGG - Intronic
991906339 5:71516152-71516174 TGTCCTGTCTTTCTTATATTTGG - Exonic
992326109 5:75661809-75661831 TCTCCTTTCTTTTCAAGGTCTGG + Intronic
992770207 5:80040554-80040576 TGTCCTCTCTGTTCCAGAACTGG - Intronic
993354084 5:86884484-86884506 TTTCCTGCCTTATTTAGATCTGG + Intergenic
993633403 5:90315203-90315225 TGTCCTGTGTTTTCTTTAACTGG + Intergenic
993975343 5:94472942-94472964 AGTGCTGTCTTTTCTAGCTTTGG - Intronic
994124066 5:96150497-96150519 TGTCCTGTGTTTCCTGAATCTGG + Intergenic
994347290 5:98701389-98701411 TGTTATTTCTTTTCTGGATCTGG - Intergenic
994664473 5:102691180-102691202 TGGCCTGTCTTCTCTAGCTCTGG + Intergenic
995835422 5:116395609-116395631 TGTCATGTCTTTTCTGGCTAGGG + Intronic
995893085 5:116978851-116978873 TACCCTGTCTTTTCTGCATCTGG - Intergenic
996293491 5:121883279-121883301 TGTTCTGTCTTTTCTTTATTGGG - Intergenic
997702918 5:135917343-135917365 TGTGCTGTTTTTCCTAGATGGGG + Intergenic
998975423 5:147640734-147640756 TGTTCTGTCTGTTCTAAATGAGG + Exonic
999912493 5:156218973-156218995 TGTCCTGTCTTGTCATTATCTGG + Intronic
1001104684 5:168843120-168843142 GGTCCTGTCTTTTCTGGACCGGG + Intronic
1001650367 5:173311454-173311476 TGTCCTGTCTCTTCTGGGGCAGG - Intergenic
1004714259 6:18201996-18202018 TGTAATGTCTTTTCTAGGTAAGG + Intronic
1005880511 6:30055400-30055422 TGACCTCTCTTTGCTAGTTCTGG - Intergenic
1007144379 6:39613014-39613036 TCTCCTCACTTATCTAGATCTGG + Intronic
1007841422 6:44718954-44718976 TCTCCTGTCTGTCCTAAATCAGG - Intergenic
1008030093 6:46685995-46686017 TGTCCTACCTTTTCTGTATCTGG - Intergenic
1009175920 6:60459891-60459913 TGGCCTGCCCTTTCTAGATTGGG + Intergenic
1009625613 6:66136582-66136604 AGCCCTGTTTTTTCTAGATCTGG - Intergenic
1010294089 6:74175884-74175906 ATTCCTGACTCTTCTAGATCAGG + Intergenic
1010803434 6:80205419-80205441 TATGCTTTCTTTTCTTGATCAGG - Intronic
1012109445 6:95209825-95209847 TCACCTGTCATTTCTAGAACTGG - Intergenic
1016577207 6:145583445-145583467 TGTGCTGTGTTTTCTAACTCTGG + Intronic
1017992405 6:159503053-159503075 CGTCCTGTCTTTCCTATGTCTGG + Intergenic
1020095270 7:5365118-5365140 TTTCCTGTCTTTTCAAGATAGGG + Intronic
1020526229 7:9262320-9262342 AATGCTGTCTTTTCTATATCAGG - Intergenic
1020997960 7:15288259-15288281 TGTACTGTATTTTCGAGGTCAGG - Intronic
1022208798 7:28188233-28188255 AATCCTTTCTTTTCCAGATCTGG + Intergenic
1030038965 7:105432952-105432974 TGTCTTGTCCTTTCTAGACAGGG + Intergenic
1032920854 7:136545058-136545080 TGCCCTCTCTTTTCCAGGTCAGG + Intergenic
1034479330 7:151307694-151307716 TGTTCTGTATTTTCTGGGTCAGG + Intergenic
1040548130 8:48417771-48417793 TTTCCTGTCTTTTATATATGGGG + Intergenic
1040842577 8:51800398-51800420 TTTCCTGTCTTATCTGAATCAGG - Intronic
1041352613 8:56963800-56963822 TGTCCTGTCTTTTCTAGATCTGG + Exonic
1041913409 8:63114042-63114064 TGTGGTGTATTTTCCAGATCTGG - Intergenic
1043813978 8:84778819-84778841 TGTCCAGGGTTTTCTAGTTCAGG + Intronic
1045361872 8:101440513-101440535 TGTCATGGCTTTTCTAGAATAGG + Intergenic
1045646084 8:104300271-104300293 TGTACTGTCTTATCTAGTTTTGG - Intergenic
1048289695 8:133171382-133171404 TGTCTTTCCTTTTCAAGATCTGG - Intergenic
1048989030 8:139750572-139750594 AGTCCTCTCTTCTCTAGTTCAGG - Intronic
1050218395 9:3356650-3356672 TGTAATGTCTTTTCTAGTTTGGG - Intronic
1051329810 9:16012239-16012261 TGGCCTGTCTTTTTTTGCTCTGG + Intronic
1051554017 9:18362643-18362665 TGTCATGCATTTTCTAGGTCTGG + Intergenic
1052376291 9:27721371-27721393 TGTTTTGTTTTTTCTAGATAGGG + Intergenic
1058776752 9:108291906-108291928 TGTGTTGTTTTTTCTATATCTGG - Intergenic
1062009587 9:134259838-134259860 TGCTCTGTCTTTTCTAGACTTGG - Intergenic
1187184519 X:16969886-16969908 TGTGCTTCCTTTGCTAGATCAGG + Intronic
1188425347 X:30040532-30040554 TTTCCTGTCTTTTGCAGATGAGG - Intergenic
1191086943 X:56578691-56578713 TGTTGTGTCTTTGCTAGATTTGG + Intergenic
1191675362 X:63786799-63786821 TGTCATGACTGTTCAAGATCTGG + Intergenic
1195170226 X:102260155-102260177 CGTCCTGTAGTTTCTGGATCTGG + Intergenic
1195188632 X:102426945-102426967 CGTCCTGTAGTTTCTGGATCTGG - Intronic
1196593097 X:117511441-117511463 TGACCAGTTTTTTCTAGAACAGG + Intergenic
1198502841 X:137269907-137269929 TGTCCCCTCTTTTCCAGATTGGG + Intergenic
1199303372 X:146238760-146238782 TATCCTGTATCTTCTAGATAGGG - Intergenic
1199685349 X:150260466-150260488 TGTATTGTCTTTTATAGTTCTGG + Intergenic
1200971655 Y:9159031-9159053 TTTCTTGTCTTTTATGGATCTGG + Intergenic
1201614702 Y:15884450-15884472 TGTCCTGTATTTCCAACATCTGG - Intergenic
1202139365 Y:21705262-21705284 TTTCTTGTCTTTTATGGATCTGG - Intergenic