ID: 1041353474

View in Genome Browser
Species Human (GRCh38)
Location 8:56973952-56973974
Sequence TCTCGGGTGGAGGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1125
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 1072}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041353474 Original CRISPR TCTCGGGTGGAGGAGGTGGA AGG (reversed) Intronic
900158657 1:1213326-1213348 TGGCGGCTGGAGGCGGTGGAGGG - Intronic
900278386 1:1848465-1848487 TCTTGGATGGAGGTGGTGGAAGG - Intronic
900311414 1:2035267-2035289 GCCAGGGTGGAGGAGGAGGAGGG - Intergenic
900345960 1:2210422-2210444 TCTGGGGTGGGGGAGGCGGCAGG - Intronic
900398229 1:2462048-2462070 TGTCAGGTGGAGGAGGTGTCAGG - Intronic
900622840 1:3595290-3595312 TCTGGGGTGGAGGTGGAGGGAGG + Intronic
900768457 1:4521005-4521027 TCACGTATGGTGGAGGTGGAGGG - Intergenic
901001689 1:6152013-6152035 TCTCGGGGGGAGTAGTTGGGTGG - Intronic
901107079 1:6764877-6764899 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
901292405 1:8134380-8134402 TCTGGAGTGGAGGAGGGGGTGGG + Intergenic
901500378 1:9649337-9649359 TCTCGGGAGGCTGAGGTGGGAGG - Intergenic
901558672 1:10052173-10052195 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
901630762 1:10647089-10647111 TCTGGGGAGGAGGAGGGGGAGGG + Intronic
901719320 1:11183374-11183396 ACTCGGGAGGTTGAGGTGGAAGG - Intronic
901719544 1:11185495-11185517 ACTCGGGAGGCTGAGGTGGATGG + Intronic
902299466 1:15491647-15491669 ACTCAGGTGGCTGAGGTGGAAGG + Intronic
902308948 1:15565758-15565780 TGGCGGGTGGAGGTGGTGGAGGG - Intronic
902364425 1:15962096-15962118 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
902770435 1:18642724-18642746 GCTGGGGTGGAGCAGGGGGAGGG + Intronic
902869175 1:19303156-19303178 TCTCGGGAGGCTGAGGTGGGAGG + Intergenic
902879539 1:19362157-19362179 TCTCTGGTCAAGGAGGTAGAAGG + Intronic
903282604 1:22258441-22258463 ACTCGGGAGGCTGAGGTGGAGGG + Intergenic
903396921 1:23008612-23008634 ACTCGGGAGGCCGAGGTGGAAGG - Intergenic
903696885 1:25214298-25214320 GCTCGGGAGGATGAAGTGGAAGG + Intergenic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
904035704 1:27557380-27557402 TCTCTGGGGAAGGAGGTGGGCGG - Intronic
904451590 1:30616366-30616388 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
904661475 1:32088620-32088642 TGTAGGGTGGAGGAGGTGGGAGG + Intronic
904668943 1:32147766-32147788 ACTTGGGAGGACGAGGTGGAAGG - Intronic
905280001 1:36842987-36843009 TGGCAGGTGGAGGGGGTGGATGG - Intronic
905691242 1:39944609-39944631 TGTGGGGAGGAGGAGGTGGGAGG - Intergenic
906083994 1:43114668-43114690 TGTGGGGTGGGGGAGGGGGAGGG - Intergenic
906198534 1:43945001-43945023 TCACTGGTGGAGGTGGTGGTGGG - Intergenic
906485367 1:46230471-46230493 ACTCGGGTGGCTGAGGTGGGAGG - Intergenic
906505339 1:46374753-46374775 ACTTGGGAGGATGAGGTGGAAGG + Intergenic
906564006 1:46783676-46783698 GTTCTGGTGGAGGTGGTGGAGGG + Intronic
906607203 1:47180891-47180913 GCTCAGGTGGAGGAGGAGAAAGG + Intergenic
906639212 1:47431659-47431681 CCTTGGGTGGTGGTGGTGGATGG + Intergenic
906752054 1:48273483-48273505 TGTGGGGTGGAGGATGGGGAGGG - Intergenic
906771094 1:48484817-48484839 TCTGGGGTGGGGGGGGGGGATGG + Intergenic
906857129 1:49320038-49320060 ACTCGGGAGATGGAGGTGGAAGG - Intronic
907676360 1:56521124-56521146 ACTCAGGTGGCTGAGGTGGAAGG + Intronic
908743537 1:67353458-67353480 ACTTGGGAGGATGAGGTGGAAGG + Intronic
908765464 1:67550893-67550915 TGTGGGGTGGGGGAGGGGGAAGG + Intergenic
909717395 1:78725645-78725667 TCTCGGGAGGCTGAGGTGGGCGG - Intergenic
910762278 1:90745565-90745587 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
910957700 1:92724697-92724719 ACTCGGGAGGCAGAGGTGGAAGG + Intronic
910979320 1:92943513-92943535 TGTGGGGTGGGGGAGGTGGTTGG - Intronic
911081948 1:93942007-93942029 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
911590936 1:99746898-99746920 GGGTGGGTGGAGGAGGTGGAAGG - Intronic
911620812 1:100065003-100065025 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
911744504 1:101425623-101425645 TGTGGGGTGGAGGAGGGGGGAGG - Intergenic
912009644 1:104943510-104943532 TTTTGGGGGGAGGAGGGGGAGGG + Intergenic
912115545 1:106402453-106402475 ACTTGGGTGGAAGAGTTGGAAGG + Intergenic
912237133 1:107864512-107864534 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
912334466 1:108849368-108849390 ACTCGGGAGGATGAGGTGGGAGG + Intronic
912551819 1:110489824-110489846 TCGGGGGTGGAGGAGGAAGAAGG - Intergenic
912909009 1:113737688-113737710 ACTTGGGTGGCTGAGGTGGAAGG + Intronic
913001182 1:114582156-114582178 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
913029257 1:114882074-114882096 TCTTGGGAGGCTGAGGTGGAAGG + Intronic
913387769 1:118278296-118278318 TCTCCTGTGGAGGAGTGGGATGG + Intergenic
913678282 1:121163582-121163604 ACTCAGGAGGCGGAGGTGGAAGG - Intergenic
914030121 1:143951222-143951244 ACTCAGGAGGCGGAGGTGGAAGG - Intronic
914159329 1:145116729-145116751 ACTCAGGAGGCGGAGGTGGAAGG + Intergenic
914721284 1:150291209-150291231 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
914798858 1:150945061-150945083 TCCCGAGTTGAGGAGGTGGATGG + Exonic
915400178 1:155616300-155616322 TCTCTGGTGAATGAGGTGGTGGG + Intergenic
915417384 1:155752495-155752517 TCTCTGGTGAATGAGGTGGTGGG + Exonic
915848700 1:159297794-159297816 TCTTGGGAGGATGAGGTGGGAGG + Intronic
917385070 1:174463510-174463532 TGTGGGGTGGGGGAGGGGGAAGG + Intronic
917405254 1:174699100-174699122 ACTTGGGAGGATGAGGTGGAAGG - Intronic
919306170 1:195841059-195841081 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
919707822 1:200695643-200695665 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
919951650 1:202369902-202369924 ACTCGGGTGGCTGAGGTGGGAGG - Intronic
920159726 1:203987265-203987287 ACTGGGGTGGCGGAGGTGGGAGG - Intergenic
920184682 1:204152298-204152320 CCTGGGGTGGAGGCGGGGGAGGG + Intergenic
920344467 1:205297256-205297278 ACTCGGGAGGATGAGGTGGGAGG - Intergenic
920370963 1:205479126-205479148 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
920465589 1:206182106-206182128 ACTCAGGAGGCGGAGGTGGAAGG - Intergenic
921056458 1:211546277-211546299 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
921154901 1:212431957-212431979 CTTTGGGTGGATGAGGTGGATGG + Intergenic
921257074 1:213351936-213351958 TCTGGGCTGGAGGTGGTGGGAGG + Intergenic
921938273 1:220814624-220814646 ACTCGGGAGGATGAGGTAGAAGG + Exonic
922113961 1:222590945-222590967 ACTCGGGAGGATGAGGTGGGAGG + Intergenic
922307410 1:224356515-224356537 TGTCGGGAGGCTGAGGTGGAAGG + Intergenic
922853566 1:228755293-228755315 ACTGGGTTGGGGGAGGTGGAGGG - Intergenic
923389030 1:233495487-233495509 ACTCAGGAGGATGAGGTGGAAGG - Intergenic
923445793 1:234070025-234070047 TTCCTGGTGGAGGAGGTGGTTGG - Intronic
923648276 1:235846124-235846146 TTTCTGGTGCAGGTGGTGGAGGG - Intronic
923741014 1:236655069-236655091 ACTCGGGTGGCTGGGGTGGAAGG - Intergenic
924379203 1:243446373-243446395 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
924464933 1:244291218-244291240 TCTCAAGTGGAGGAGAAGGAGGG + Intergenic
924470337 1:244337604-244337626 TTTCGGGGGGCCGAGGTGGACGG + Intergenic
924624907 1:245689427-245689449 TTTGGGGTGGAGGTGGAGGAAGG - Intronic
924728391 1:246690649-246690671 TCTCAGGAGGTTGAGGTGGACGG + Intergenic
1063346736 10:5318775-5318797 TCTCTGAGGGAGGAGGTCGAAGG - Intergenic
1063372998 10:5533762-5533784 ACACGTGTGAAGGAGGTGGATGG + Intergenic
1063503822 10:6579287-6579309 ACTAGGCTGGAGAAGGTGGAGGG - Intronic
1063522695 10:6755192-6755214 TCTCAGTTGGGGCAGGTGGATGG + Intergenic
1064002297 10:11673741-11673763 TAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1064583458 10:16816931-16816953 TCTCCCGTGGATGAGCTGGAAGG - Intronic
1064586934 10:16848808-16848830 TCTCGGGAGACTGAGGTGGAAGG - Intronic
1064589090 10:16869809-16869831 TCATGGGAGCAGGAGGTGGAGGG + Exonic
1065184483 10:23158661-23158683 TCTCGGGTGGTGGGAGGGGAGGG - Intergenic
1065295375 10:24269413-24269435 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1065322153 10:24519979-24520001 TTTCGTGTGGTGGTGGTGGAGGG - Intronic
1065388278 10:25155901-25155923 ACTCGGGAGGTTGAGGTGGAAGG + Intergenic
1065506827 10:26438145-26438167 TCTCGGGTGGGGGTGGAGGAAGG - Intergenic
1065546568 10:26827462-26827484 TTTTGGGAGGCGGAGGTGGATGG - Intronic
1065574163 10:27101530-27101552 TCCCTTGTGGAGGAGGTGGCTGG + Intergenic
1065586577 10:27224266-27224288 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1065624235 10:27614402-27614424 TCGGGGGTGAAGGAGGAGGAAGG - Intergenic
1065866003 10:29916137-29916159 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1066087553 10:31985787-31985809 ACTTGGGAGGAGGAGGTGGGGGG - Intergenic
1066129750 10:32381354-32381376 GCAGAGGTGGAGGAGGTGGAAGG + Intergenic
1066193732 10:33078968-33078990 ACTTGGGAGGTGGAGGTGGAAGG - Intergenic
1067950196 10:50728230-50728252 ACTTGGGAGGATGAGGTGGAAGG + Intergenic
1068390837 10:56394883-56394905 TCTGGGGTGGGGGAGGGGGGAGG - Intergenic
1068650751 10:59519895-59519917 TCTGGGGTGGAGAAGCTGCAAGG + Intergenic
1068865455 10:61890156-61890178 TCCCTGGTGGATGGGGTGGAGGG + Intergenic
1068882878 10:62068468-62068490 TCTGAGGAGGAGGAGGTGGCTGG - Intronic
1068928950 10:62568806-62568828 TCTTGGGAGGCTGAGGTGGAAGG + Intronic
1069514591 10:69067632-69067654 TCTTGGGAGGATGAGGTGGAAGG - Intergenic
1069651429 10:70052810-70052832 TAGCGGGGGGAGGAGGAGGAGGG - Exonic
1069690168 10:70346305-70346327 ACTCGGGAGGATGAGGTGGGAGG + Intronic
1070106838 10:73441357-73441379 TCTCGGATGGCTGAGGTGGAAGG + Intronic
1070262643 10:74872482-74872504 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1070558913 10:77551073-77551095 ACTCGGGAGGATGAGGTGGGAGG - Intronic
1070568200 10:77619896-77619918 TGGAGGATGGAGGAGGTGGAGGG + Intronic
1071478262 10:86042974-86042996 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1071548285 10:86545309-86545331 TCTGTGGTGGAGGGGGTGGTGGG + Intergenic
1072219544 10:93316014-93316036 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1072575037 10:96691494-96691516 TCTTGGATGGGGGAGGTGGTGGG + Intronic
1072676774 10:97472716-97472738 ACTCGGGAGGTGGAGGTGGGAGG - Intronic
1073243365 10:102072682-102072704 TCTCGGGAGGTTGAGGTGGGAGG + Intergenic
1073245072 10:102084331-102084353 ACTCGGGAGGATGAGGTGGGAGG + Intergenic
1073688618 10:105783377-105783399 TCTGGGCTGGAGGGGGTGGGGGG - Intergenic
1074036901 10:109748367-109748389 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1074815005 10:117136701-117136723 GCTCGGGCCAAGGAGGTGGAGGG - Intronic
1074884365 10:117683235-117683257 TCTGGGGTGGAGGAGTTGAGGGG - Intergenic
1075042404 10:119118777-119118799 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1075325839 10:121531617-121531639 TATGGGGAGGAGGAGGTGGTAGG - Intronic
1075593570 10:123710449-123710471 GATCAGGTGGAGCAGGTGGAGGG + Intronic
1075689439 10:124385704-124385726 TCTCAGGTGCAGGAGGCTGAGGG + Intergenic
1075801057 10:125153513-125153535 TCTCTGCTGGAGGGGGTGAAAGG - Intronic
1076161323 10:128246309-128246331 TCTCTGGGGGTGGTGGTGGAGGG + Intergenic
1076525341 10:131109066-131109088 TGTGGGGTGGGGGGGGTGGAGGG + Intronic
1077264431 11:1641980-1642002 TCTCGGGTGGAGGTGGTCTGGGG - Intergenic
1077264467 11:1642090-1642112 TCTCGGGTGGAGGTGGTTTGGGG - Intergenic
1077402534 11:2366306-2366328 GCTCGGGTGGAGTGGGTGGGTGG - Intergenic
1077658554 11:4045873-4045895 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1077899920 11:6479926-6479948 TCTTGGGTGGAGGAGGGGACAGG - Intronic
1078147423 11:8731055-8731077 TCTGGGGTGAAGGAGCTGGGGGG + Exonic
1078203456 11:9205786-9205808 ACTCGGGTGGCTGAGGTGGGAGG + Intronic
1078240444 11:9526243-9526265 ACTCAGGTGGCTGAGGTGGAAGG + Intronic
1078537079 11:12183886-12183908 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1078578516 11:12520841-12520863 CCTCGGGAGGCTGAGGTGGAAGG + Intronic
1078733778 11:14001104-14001126 TCTTGGGGGGTGGAGGAGGAAGG - Intronic
1078784778 11:14478329-14478351 TCTGGGGAGGATGAGGTGGGAGG + Intronic
1079036962 11:17028305-17028327 TCTCAGGAGGATGAGATGGAAGG + Intergenic
1079251901 11:18792741-18792763 TCCCGGGGGGCGGGGGTGGATGG - Intergenic
1079393677 11:20043548-20043570 ACTCGGGTGGTTGAGGTGGGAGG - Intronic
1080517179 11:33035281-33035303 ACAGAGGTGGAGGAGGTGGAAGG - Intergenic
1080574956 11:33589759-33589781 TGTGGGGTGGGGGAGGTGGGAGG + Intronic
1080606990 11:33871457-33871479 ACTCGGGAGGCGGAGGTGGGAGG + Intronic
1080684861 11:34506620-34506642 ACTCGGGAGGTGGAGGTGGGAGG - Intronic
1080852544 11:36082398-36082420 ACTCGGGAGGATGAGGTGGGAGG + Intronic
1081197198 11:40176117-40176139 TCTCTGGTGGAGGAGGATGGGGG + Intronic
1081659287 11:44878137-44878159 TCTGGGGTGGAGCTGGGGGAAGG - Intronic
1081828257 11:46080265-46080287 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1081864956 11:46354293-46354315 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1081994347 11:47353978-47354000 TCTGGGGTTGAGGAGGTGTGGGG + Intergenic
1082849720 11:57754139-57754161 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1083211334 11:61188990-61189012 TCTTGGGAGGCTGAGGTGGAAGG - Intergenic
1083303235 11:61749692-61749714 CCCCGGGTGGAGGAGGGGCAGGG + Intergenic
1083326187 11:61874078-61874100 TGTCGGGTAGGGGAGCTGGAGGG + Intronic
1083564378 11:63700710-63700732 TCTCAGGAGGCTGAGGTGGAAGG - Intronic
1083587007 11:63867489-63867511 TCTCTTGGGAAGGAGGTGGAAGG - Intronic
1083948922 11:65943034-65943056 ACTCGGGTGGCTGAGGTGGGAGG + Intergenic
1084112301 11:67022326-67022348 TCTGGGGTGGGGGAGGAAGAGGG - Intronic
1084168491 11:67388693-67388715 ACTCGGGAGGTTGAGGTGGAAGG + Intronic
1084180349 11:67442909-67442931 TGTCGGGGGCAGGAGGTGGGAGG + Intronic
1084197138 11:67529874-67529896 ACTCGGGTGGCTGAGGTGGGAGG + Intergenic
1084215378 11:67644610-67644632 TCTCGGGTTGAGGAGCAGGATGG - Intronic
1084270029 11:68023934-68023956 GCTCGGGAGGCTGAGGTGGAAGG + Intronic
1084756060 11:71239567-71239589 TCTCGGGAGGCTGATGTGGAAGG - Intronic
1085029182 11:73259298-73259320 TCTCGGGAGGCTGAGGTGGGAGG + Intergenic
1085199247 11:74691814-74691836 ACTCTGATGGAGGAGGTGGCAGG + Intergenic
1085223171 11:74893403-74893425 TGTGGGGTGGGGGAGGGGGAGGG + Intronic
1085589702 11:77748331-77748353 TCTCGGGTGGCTGAGGTGGGAGG - Intronic
1085717504 11:78885814-78885836 GCTCGGGAGGCTGAGGTGGAAGG + Intronic
1085752720 11:79175981-79176003 ACTCGGGAGGAAGAGGTGGGAGG + Intronic
1085871887 11:80359822-80359844 TAGGAGGTGGAGGAGGTGGAAGG + Intergenic
1086365567 11:86106413-86106435 TGTGGGGTGGGGGAGGGGGAAGG + Intergenic
1087282539 11:96227991-96228013 ACTCGGGGGGCTGAGGTGGAAGG + Intronic
1087723510 11:101693491-101693513 TCTTGGGAGGCTGAGGTGGAAGG - Intronic
1087792876 11:102425690-102425712 TCTCGGGTGGGTGAAGTGGGAGG - Intronic
1089028287 11:115294789-115294811 CCTTGGGAGGAGGAGGTGGGTGG + Intronic
1089178802 11:116566816-116566838 ACTTGGCAGGAGGAGGTGGACGG - Intergenic
1089827613 11:121292919-121292941 ACTCGGGTGGGCGAGGCGGAAGG + Intronic
1089959928 11:122607310-122607332 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1090765270 11:129870916-129870938 TGTGGAGTGGAGTAGGTGGAGGG - Intronic
1090802504 11:130181642-130181664 TCCTGGGTGGGGGAGGTGGGAGG - Intronic
1091490720 12:930268-930290 TCTCGGGAGGCTGAGGTGGGAGG + Intronic
1091560502 12:1609214-1609236 TCTCGGGAGGCTGAGGTGGGAGG - Intronic
1091696642 12:2632399-2632421 TCTTGGGTGTAGGAGGTGTAGGG - Intronic
1091697133 12:2635238-2635260 TCTTGGGAGAAGGAGGTGGCAGG - Intronic
1091962870 12:4713428-4713450 GCTGGGTGGGAGGAGGTGGAGGG - Intronic
1092118891 12:6029925-6029947 TCTGGGGAGGGGGAGGTGGTGGG - Intronic
1092361447 12:7840001-7840023 ACTCGGGTGGCTGAGGTGGGAGG + Intronic
1092385620 12:8033637-8033659 TCAAGGTTGGAGGAGGGGGAGGG - Exonic
1092658224 12:10710089-10710111 GCTGGGGAGGAGGAGGAGGAAGG - Exonic
1093172625 12:15876298-15876320 GTTCTGGTGGAGGTGGTGGAGGG - Intronic
1093189101 12:16054814-16054836 TGTCAGATGGTGGAGGTGGAGGG + Intergenic
1093737319 12:22636052-22636074 ACTCGGGTGGCTGAGGTGGGAGG + Intronic
1094122468 12:26988831-26988853 TCAGGGGTGGCAGAGGTGGAAGG - Intronic
1094298547 12:28935433-28935455 ACTCAGGTGGCTGAGGTGGAAGG + Intergenic
1094305290 12:29012349-29012371 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1094475443 12:30837259-30837281 GTTCGGGTGGAGCAGGTGGCAGG - Intergenic
1095762517 12:45855823-45855845 TCTTGGGAGGCTGAGGTGGAAGG - Intronic
1096005623 12:48168756-48168778 TTTGGGGTGGAGGGGGTGGGCGG + Intronic
1096363411 12:51007747-51007769 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1096370206 12:51063250-51063272 TCTAGGGAGGAGGGAGTGGAAGG - Exonic
1096644818 12:53026708-53026730 ACTTGGGAGGATGAGGTGGAAGG - Intronic
1096671959 12:53205291-53205313 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1096866561 12:54567392-54567414 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1097040263 12:56152287-56152309 TCTCGGGAGGTGGAGGGGGCGGG - Exonic
1097094485 12:56535384-56535406 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1097590894 12:61573940-61573962 ACTCACATGGAGGAGGTGGAAGG - Intergenic
1097760595 12:63459780-63459802 GCTCTGGTGGAGGTGGTGGGGGG - Intergenic
1097868909 12:64583714-64583736 GTTAGGGTGGAGGAGTTGGATGG - Intergenic
1097945034 12:65358224-65358246 ACTCGGGGGGTTGAGGTGGAAGG - Intronic
1098063138 12:66584256-66584278 TGTGGGGTGGGGGAGGTGGGAGG + Intronic
1098895159 12:76051606-76051628 GCTCTGGTGGCGGAGGTGGAAGG - Intronic
1098951113 12:76641442-76641464 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1098960015 12:76730043-76730065 ACTCGGGAGGTTGAGGTGGAAGG - Intergenic
1099211809 12:79800264-79800286 TCAGAGGTGGTGGAGGTGGAAGG - Intronic
1099795997 12:87399900-87399922 TGTGGGGTGGGGGAGGGGGAAGG + Intergenic
1100033263 12:90219285-90219307 TCTAGGGGCGAGGTGGTGGAGGG - Intergenic
1100497484 12:95139329-95139351 ACTTGGGTGGGTGAGGTGGAAGG + Intronic
1101013663 12:100476776-100476798 GCTCGGGCGGCTGAGGTGGAAGG + Intronic
1101352815 12:103948273-103948295 TCTTGGGAGGCGGAGGTGGGTGG - Intronic
1101493845 12:105235795-105235817 TCTCGGGCTGAGGAGGGGGCGGG - Intronic
1101907391 12:108837889-108837911 ACTTGGGTGGTTGAGGTGGAAGG - Intronic
1102067366 12:109988431-109988453 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1102104786 12:110312068-110312090 TCTCGGGAGGCTGAGGTGGGAGG + Intronic
1102480037 12:113216588-113216610 ACTCTGGTGGGGGAGGTTGACGG + Intronic
1102496470 12:113322839-113322861 ACTCAGGAGGAGGAGGTGGGAGG + Intronic
1102543898 12:113641205-113641227 GCTGGGGTGGAGGTGGAGGAAGG - Intergenic
1102772074 12:115486765-115486787 TCTCGGGGGTTGGAGGAGGAGGG - Intergenic
1102979196 12:117227920-117227942 TCTTGGGAGGATGAGGTGGGAGG + Intronic
1103479789 12:121243653-121243675 ACTGGGGTGGGGGAGTTGGATGG + Intronic
1103827490 12:123751543-123751565 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1103968531 12:124655204-124655226 GCCAGGCTGGAGGAGGTGGATGG - Intergenic
1104559818 12:129833514-129833536 ACTTGGGAGGAGGAGGTGGGAGG + Intronic
1104788233 12:131465305-131465327 TGAGAGGTGGAGGAGGTGGAAGG - Intergenic
1104789249 12:131471620-131471642 CCTGGGATGGAGGACGTGGATGG + Intergenic
1104812392 12:131626934-131626956 TCTCGGGTGGATGGGGAGAAGGG - Intergenic
1104812402 12:131626968-131626990 TCTCGGGTGGATGGGGAGAAGGG - Intergenic
1104812569 12:131627546-131627568 TCTCGGGTGGATGGGGAGAAGGG - Intergenic
1104812590 12:131627614-131627636 TCTCGGGTGGATGGGGAGAAGGG - Intergenic
1104812640 12:131627784-131627806 TCTCGGGTGGATGGGGTGAGGGG - Intergenic
1105322666 13:19343890-19343912 TGTCGGGGGGAGGGGGTGGGGGG + Intergenic
1105559642 13:21478498-21478520 ACTTGGGAGGATGAGGTGGAAGG + Intergenic
1105957481 13:25297935-25297957 ACTCGGGTGGCTGAGGTGGGAGG + Intergenic
1105994154 13:25654312-25654334 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1106152680 13:27121366-27121388 TGTGGAGTGGAAGAGGTGGAAGG - Intronic
1106154774 13:27144093-27144115 TCTCGGGAGGCTGAGGTGGGAGG + Intronic
1106241292 13:27915761-27915783 TGGTGGGAGGAGGAGGTGGAAGG + Intergenic
1106591519 13:31102537-31102559 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1107123714 13:36821552-36821574 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1107134639 13:36930518-36930540 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1107514644 13:41117076-41117098 TCTCAGGAGGCTGAGGTGGAAGG + Intergenic
1107676146 13:42799084-42799106 ACTCGGGAGGCGGAGGTGGGAGG + Intergenic
1107890803 13:44912568-44912590 TCTCGGGTGGGGAAGCTGGGAGG + Intergenic
1108499619 13:51057875-51057897 ACTCTGGTGGCTGAGGTGGAAGG + Intergenic
1108781129 13:53835525-53835547 GCAGAGGTGGAGGAGGTGGAAGG - Intergenic
1109140188 13:58704853-58704875 TTTCAGGTGCAGGATGTGGAAGG + Intergenic
1109715437 13:66215939-66215961 GCTTGGCTGGATGAGGTGGAAGG - Intergenic
1110217195 13:73036254-73036276 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1110247297 13:73341469-73341491 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1110417255 13:75267185-75267207 ACTCGGGAGGATGAGGTGGGAGG - Intergenic
1111897856 13:94163330-94163352 TCAAGGGAGGTGGAGGTGGAAGG - Intronic
1112492687 13:99881529-99881551 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1112780185 13:102891933-102891955 CCTTGGGAGGTGGAGGTGGATGG - Intergenic
1113146060 13:107208886-107208908 TCTCTGCTGGAGGGGGAGGAGGG - Intronic
1113286214 13:108851939-108851961 CCTGGCGTGGAGGAGGTGGGAGG - Intronic
1114849007 14:26359935-26359957 GCTCGGGAGGCGGAGGTGGGAGG + Intergenic
1116102754 14:40463620-40463642 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1116201681 14:41805547-41805569 TGTGGGGTGGGGGGGGTGGAGGG - Intronic
1116728147 14:48588460-48588482 TTTCTGGTGGTGAAGGTGGAAGG + Intergenic
1116807849 14:49511010-49511032 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1117071994 14:52066159-52066181 TCTGGGGTGGGGGAGGTTTAGGG - Intronic
1117149273 14:52868739-52868761 ACTCGGGAGGCAGAGGTGGAAGG + Intronic
1117311199 14:54524936-54524958 ACTCGGGAGGATGAGGTGGGAGG + Intronic
1117639623 14:57784789-57784811 TCATGGGTGGCAGAGGTGGAAGG - Intronic
1117830034 14:59741160-59741182 GCTTGGCTGGAGGAGGGGGAAGG - Intronic
1117887500 14:60380541-60380563 ACTCGGGAGGCTGAGGTGGAGGG + Intergenic
1117922728 14:60742192-60742214 TCTGGGGTGGCTGAAGTGGAAGG - Intronic
1117944922 14:61009528-61009550 TGTGGGGTGGGGGAGGGGGAGGG - Intronic
1117947300 14:61041789-61041811 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1118285977 14:64473259-64473281 TTTGAGGTGGAGGAGGTGGCAGG - Exonic
1118550806 14:66947712-66947734 ACTCGGGAGGCTGAGGTGGAGGG + Intronic
1118803864 14:69217296-69217318 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1118942032 14:70347184-70347206 TCTTGGGTGGAGTAGGTGACTGG - Intronic
1119019302 14:71093720-71093742 TCAGAGGTGGAGGAGGTGGAAGG - Intronic
1119031599 14:71197088-71197110 TCCTGGGTGGCGGAGGTGGGTGG + Intergenic
1119310236 14:73640194-73640216 TTTTTGGTGGAGAAGGTGGAAGG - Intergenic
1119394016 14:74312557-74312579 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1120518127 14:85494150-85494172 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1120711309 14:87796023-87796045 TCTCAGGTGGCTGAGGTGGGAGG + Intergenic
1120997547 14:90428045-90428067 TGCCGGGTGGGGGATGTGGAAGG - Intergenic
1121026879 14:90622619-90622641 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1121116243 14:91344903-91344925 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1121600126 14:95197138-95197160 ACTCGGGAGGTGGAGGTGGGAGG + Intronic
1121629091 14:95409518-95409540 TCTCGGCTGGACAAGGTGGTTGG + Intronic
1121682288 14:95803605-95803627 TGTGGGGTGGGGGAGCTGGAAGG + Intergenic
1122237141 14:100337747-100337769 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1122726831 14:103761163-103761185 ACTTGGGAGGATGAGGTGGAAGG + Intronic
1122737774 14:103853550-103853572 TCTCAGGAGGCTGAGGTGGAAGG + Intergenic
1122957975 14:105080676-105080698 TCTTGGGAGGCTGAGGTGGAAGG - Intergenic
1123438437 15:20272670-20272692 GCTGGGGGAGAGGAGGTGGAGGG - Intergenic
1124303697 15:28564016-28564038 GCACGGGTGAAGGATGTGGAGGG - Intergenic
1124895184 15:33769838-33769860 ACTCGGGTGGCTGAGGTGGGAGG + Intronic
1124913615 15:33947084-33947106 TAACTGGTGGAAGAGGTGGAGGG + Intronic
1125589600 15:40846014-40846036 TCTGGGGTGGGGGATGAGGAGGG + Intronic
1125697928 15:41654755-41654777 CTTTGGGAGGAGGAGGTGGAAGG - Intronic
1125801762 15:42454788-42454810 TCTCGGGAGGTTGAGGTGGGAGG + Intronic
1125921179 15:43526864-43526886 TCTCAGGTGGGGAAGCTGGAGGG - Exonic
1125961705 15:43835378-43835400 ACTGGGGTGGCTGAGGTGGAAGG + Intronic
1126006603 15:44264054-44264076 ACTCGGGTGGCAGAGGTGGGAGG - Intergenic
1126121039 15:45251873-45251895 ACTCGGCAGGCGGAGGTGGAAGG - Intergenic
1126148154 15:45496916-45496938 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1126149515 15:45509961-45509983 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1126570195 15:50142453-50142475 TTTGGGGAGGAGGAAGTGGATGG - Intronic
1126641817 15:50835356-50835378 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1127248067 15:57199988-57200010 ACTTGGGAGGATGAGGTGGAAGG - Intronic
1127509151 15:59623243-59623265 ACTCAGGTGGCCGAGGTGGAAGG - Intronic
1127564771 15:60176419-60176441 ACTCGGGAGGATGAGGTGGGAGG + Intergenic
1127891273 15:63253571-63253593 GCTCGGGAGGCGGAGGTGGGAGG + Intronic
1128179500 15:65589264-65589286 ACTCAGGGGGCGGAGGTGGAAGG - Intronic
1128203240 15:65827975-65827997 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1128514414 15:68333568-68333590 TTACGGGTGGGAGAGGTGGAGGG - Intronic
1128541822 15:68541124-68541146 ACTCGGGAGGATGAGGTGGGAGG + Intergenic
1128740032 15:70077539-70077561 CCAAGGGTGGAGGGGGTGGAGGG - Intronic
1128768298 15:70264503-70264525 TTTCGGGTGGGGGCGGTGGGGGG - Intergenic
1129041535 15:72691091-72691113 ACTCGGGAGGTTGAGGTGGAAGG - Intronic
1129041666 15:72692422-72692444 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1129053200 15:72799372-72799394 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1129056717 15:72825737-72825759 TCCAGGGTGGAGGTGGTGGCTGG + Intergenic
1129309607 15:74696786-74696808 TCTCTGGTGATGGAGGGGGAAGG - Intergenic
1129357604 15:75001995-75002017 ACTTGGGTGGCTGAGGTGGAAGG + Intronic
1129609103 15:77038825-77038847 CCCCAGGTGGAGGAGCTGGAGGG + Intergenic
1130073948 15:80672773-80672795 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1130112030 15:80973428-80973450 TCTCGGGAGGCTGAGGTGGGAGG + Intronic
1130288631 15:82576914-82576936 ACTTGGGTGGCTGAGGTGGAAGG + Intronic
1130821623 15:87502146-87502168 CCTGGCCTGGAGGAGGTGGAGGG - Intergenic
1131140501 15:89973217-89973239 TCCCTGATGGAGGAGGTGGTTGG - Intergenic
1131166779 15:90147629-90147651 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1131201733 15:90403165-90403187 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1132122611 15:99190888-99190910 ACTCGGGTGGCTGAGGTGGGAGG - Intronic
1132529393 16:438107-438129 TCTCAGGAGGAGGTGGGGGAAGG - Intronic
1132538878 16:498280-498302 CCTCAGGAGGAGGAGGTGGGAGG - Intronic
1132548707 16:545363-545385 TCTCGGTGGGCCGAGGTGGAAGG - Intronic
1132596969 16:756815-756837 ACTTGGGAGGAGGAGGTGGGAGG - Intronic
1133041057 16:3059870-3059892 CCTGGGGAGGAGGAGGTGGGTGG - Exonic
1133065328 16:3202488-3202510 TCTGGGGAGGAGGAGGAGAATGG - Intergenic
1133133846 16:3695425-3695447 ACTCGGGAGGCCGAGGTGGAAGG + Intronic
1133158355 16:3891654-3891676 TCTCAGGAGGCGGAGGTGGGAGG + Intergenic
1133276745 16:4642893-4642915 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1133933891 16:10253333-10253355 TCTCAGGAGGCTGAGGTGGAAGG + Intergenic
1133978901 16:10619290-10619312 TCTGGGCTGGAGGAGGTGGGTGG - Intergenic
1134138335 16:11695618-11695640 ACTTGGGTGGTAGAGGTGGAGGG - Intronic
1134210760 16:12274643-12274665 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1134327848 16:13223319-13223341 TCTCGGGAGGCTGAGGTGGGAGG + Intronic
1134653118 16:15926436-15926458 TGCGGGGTGGAGGTGGTGGAGGG - Intergenic
1135381892 16:22002666-22002688 ACTCTGGTGGCTGAGGTGGAAGG - Intergenic
1135414071 16:22255799-22255821 TCTCGGGAGGCTGAGGTGGGAGG + Intronic
1135515959 16:23133966-23133988 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1135728454 16:24875291-24875313 ACTCAGGTGGCTGAGGTGGAAGG - Intronic
1136111996 16:28069307-28069329 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1136124551 16:28168372-28168394 TCTGGGGAGGCTGAGGTGGAAGG + Intronic
1136359599 16:29770108-29770130 TCTTGGGAGGCTGAGGTGGAAGG + Intergenic
1137471784 16:48767479-48767501 TCTTGGGTGGCTGAGGTGGGAGG - Intergenic
1137585184 16:49660003-49660025 TTGCGGGTGGAGGAGGAGGAAGG - Intronic
1137594699 16:49715937-49715959 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1137623286 16:49891102-49891124 TCTGGGGAGGAGGAAGTGCAGGG + Intergenic
1137834142 16:51574562-51574584 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1138025960 16:53522756-53522778 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1138481522 16:57306532-57306554 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1138606747 16:58094666-58094688 TCTCGGGAGGGTGAGGTAGAAGG + Intergenic
1138788141 16:59870386-59870408 TGTGGGGTGGGGGAGGGGGAAGG - Intergenic
1139010795 16:62631459-62631481 TGTGAGGTGGAGGAGGGGGAAGG - Intergenic
1139059006 16:63225441-63225463 ACATGGGTGGAGCAGGTGGAAGG + Intergenic
1139434658 16:66929107-66929129 ACTCGGGAGGCGGAGGTGGGAGG - Intergenic
1139524882 16:67509024-67509046 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1139686132 16:68605146-68605168 TCTGGGGTGGAGGAGGAGAGGGG - Intergenic
1139876325 16:70149001-70149023 ACTCGGGAGGCGGAGGTGGGAGG - Intronic
1139877375 16:70157061-70157083 TATTAGGAGGAGGAGGTGGAAGG - Exonic
1139918466 16:70442927-70442949 GCTCGGGAGGCTGAGGTGGAAGG - Intergenic
1139944327 16:70628894-70628916 CCTCGGGAGGCCGAGGTGGAAGG - Intronic
1140359464 16:74332130-74332152 ACTCGGGAGGCGGAGGTGGGAGG + Intergenic
1141054890 16:80804895-80804917 TCGAGGGTGGAGGAGGTAGGTGG - Intergenic
1141535281 16:84675137-84675159 ACTCGGGTGGCTGAGGTGGGAGG - Intergenic
1141793692 16:86254148-86254170 ACTTGGGTGGCTGAGGTGGAAGG - Intergenic
1142044010 16:87913696-87913718 TGTGGGGTGGAGGAGGAGGGAGG - Intronic
1142237146 16:88927704-88927726 CCTGGGGAGGAGGAGGCGGAAGG - Intronic
1142262531 16:89049643-89049665 TCTCGGGAGGCGGAGGCGGCAGG + Intergenic
1203141663 16_KI270728v1_random:1771309-1771331 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141710 16_KI270728v1_random:1771452-1771474 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1142636031 17:1258348-1258370 GCTCGGGAGGCTGAGGTGGAAGG + Intergenic
1142750300 17:1983505-1983527 GCTCGGGTGGCTGAGGTGGGAGG - Intronic
1142806601 17:2374466-2374488 TCTCGGGAGGCTGAGGTGGGGGG + Intronic
1142824965 17:2504662-2504684 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1142833438 17:2566450-2566472 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1142886449 17:2915337-2915359 ACTCGGGGGGCTGAGGTGGAAGG - Intronic
1143134060 17:4700814-4700836 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1143494598 17:7305199-7305221 TCTTGGGAGGCTGAGGTGGAGGG - Intergenic
1143514387 17:7412078-7412100 GGTCGGGGGGAGGTGGTGGATGG - Intronic
1143666075 17:8361664-8361686 ACTTGGGTGGCTGAGGTGGAAGG - Intergenic
1143774288 17:9187566-9187588 CCTCGGGAGGCTGAGGTGGATGG + Intronic
1143886485 17:10068653-10068675 TCTCGGGAGGCTGAGATGGAAGG + Intronic
1143917548 17:10305058-10305080 TCCTGGGTCCAGGAGGTGGAGGG - Intronic
1143993431 17:10986639-10986661 CCTCGGGAGGCTGAGGTGGATGG + Intergenic
1144123538 17:12179844-12179866 TGTGGGGTGGGGGAGGGGGAGGG - Intergenic
1144195181 17:12887335-12887357 ACTCGGGTGGCTGAGGTGGGAGG - Intronic
1144373352 17:14614472-14614494 TCTCGGGAGGCTGAGGTGGGAGG - Intergenic
1144452250 17:15390818-15390840 TCTCGGTGAGAGGTGGTGGACGG + Intergenic
1144550966 17:16240607-16240629 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1144821718 17:18079427-18079449 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1144872612 17:18380432-18380454 CCTGGGGTGGAGGAGGTATAGGG + Intronic
1145792992 17:27639343-27639365 TGGGGGGTGGGGGAGGTGGAGGG - Intronic
1145889901 17:28407021-28407043 ACTCGGGTGGCTGAGGTGGGAGG + Intronic
1146010473 17:29190466-29190488 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1146074751 17:29717789-29717811 ACTCTGGAGGATGAGGTGGAAGG + Intronic
1146102210 17:29993993-29994015 TCTTGGGTGGCTGAGGTGGGAGG + Intronic
1146210644 17:30940068-30940090 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1146366483 17:32232994-32233016 TCTGGGGTGGGGGTGGGGGAAGG - Intronic
1146636290 17:34507832-34507854 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1146721263 17:35125328-35125350 ACTCAGGAGGTGGAGGTGGACGG + Intronic
1146965835 17:37029165-37029187 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1147034552 17:37670576-37670598 TCTCGGGAGAAGCAGGAGGAGGG + Intergenic
1147567289 17:41545664-41545686 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1147776808 17:42907642-42907664 ACTGGGGTGTAGGTGGTGGAGGG + Intronic
1147933386 17:43996794-43996816 ACTCGGGTGGCTGAGGTGGGAGG - Intronic
1148107626 17:45127839-45127861 TCATGGGTGGAGAGGGTGGAAGG + Intronic
1148146769 17:45370851-45370873 TTTTGGGTGAAGGAAGTGGATGG + Intergenic
1148164827 17:45476040-45476062 ACTCGGGAGGTTGAGGTGGAAGG + Intronic
1148375984 17:47146819-47146841 ACTCGGGTGGGTGAGGTGGGAGG + Intronic
1148630483 17:49104379-49104401 TCTTGGGAGGCGGAGGTGGGAGG + Intergenic
1148756720 17:49976904-49976926 TCTTGGGTGGGGGTGGGGGATGG - Intergenic
1149300952 17:55304304-55304326 CCCAGGGAGGAGGAGGTGGAAGG + Intronic
1149459593 17:56816956-56816978 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1149741061 17:59045905-59045927 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1149810481 17:59665114-59665136 ACTCGGGTGGCTGAAGTGGAGGG + Intronic
1149866933 17:60156360-60156382 TCTGTGGAGGAGGAGGAGGAGGG + Intronic
1149904201 17:60510292-60510314 ACTTGGGTGGCTGAGGTGGAAGG + Intronic
1150302676 17:64059514-64059536 GAGCCGGTGGAGGAGGTGGAAGG - Intronic
1150339522 17:64355397-64355419 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1150396046 17:64822707-64822729 ACTCGGGAGGTTGAGGTGGAAGG + Intergenic
1150423182 17:65056634-65056656 CCGCCGGAGGAGGAGGTGGAGGG - Exonic
1150433826 17:65139176-65139198 GCTGGGGAGGAGGAGGAGGATGG - Intronic
1150608096 17:66711699-66711721 GCTCGGGTGGAGGATTTGCAAGG + Intronic
1151325399 17:73376867-73376889 TCTGGGGTGAAGGAGGAGGAAGG - Intronic
1151347564 17:73511534-73511556 TCTGGGGAGGAGGAGAGGGAAGG + Intronic
1151484901 17:74392763-74392785 TCTTGGGAGGCTGAGGTGGAAGG + Intergenic
1151590544 17:75041244-75041266 ACTCGGGGGGATGAGGTGGGAGG + Intronic
1151748640 17:76024590-76024612 CCTGGGGTGGAGGAGGTATAGGG - Intronic
1151873632 17:76853517-76853539 ACTCGGGAGGTGGAGGTGGGAGG - Intergenic
1152084496 17:78209686-78209708 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1152103177 17:78314466-78314488 GCTCGGCTGGAGGAGGTGCTGGG + Intergenic
1152356659 17:79810811-79810833 TCTAGGGGGGAGGTGGCGGAGGG - Intergenic
1152472710 17:80499274-80499296 CGCCGGGTGGAGGAGGTGGGAGG + Intergenic
1152615513 17:81336123-81336145 ACAGGGGTGGAGGAGGGGGAGGG - Intergenic
1152711553 17:81872798-81872820 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1152712127 17:81877088-81877110 ACTCGGGAGGATGAGGTGGGAGG - Intergenic
1152774407 17:82191532-82191554 GCAGAGGTGGAGGAGGTGGAAGG - Intronic
1152832496 17:82506624-82506646 ACTCGGGAGGATGAGGTGGGAGG - Intergenic
1152856856 17:82669542-82669564 TCTCAGGAGGCTGAGGTGGAAGG + Intronic
1152910373 17:83001876-83001898 TCTCGGGAGGCTGAGGTGGGAGG - Intronic
1153029270 18:698727-698749 ACTCAGGAGGCGGAGGTGGAAGG - Intronic
1154196281 18:12269804-12269826 ACTTGGGAGGAGGAGGTGGCAGG - Intronic
1155245256 18:23902215-23902237 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1156333863 18:36151191-36151213 ACTCGGGAGGTGGAGGTGGGAGG - Intronic
1156465657 18:37346704-37346726 TTTGGGGAGGAGTAGGTGGAAGG + Intronic
1156472399 18:37385572-37385594 TGTGGGCTGGGGGAGGTGGAGGG - Intronic
1157136696 18:45063524-45063546 TCTTGGGTAGAGGGGGTGGCGGG - Exonic
1157409865 18:47454580-47454602 TCAGGGGTGGTGGAGGTGGTGGG + Intergenic
1157622637 18:49025223-49025245 TCTGGGGGGGTGGGGGTGGAAGG - Intergenic
1158099856 18:53818947-53818969 CCTGGGCTGGAGGAGGAGGAAGG + Intergenic
1158497779 18:57971969-57971991 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1158852692 18:61511253-61511275 ACTCAGGAGGATGAGGTGGAAGG + Intronic
1158989783 18:62856534-62856556 ACTCGGGAGGCTGAGGTGGACGG - Intronic
1159108183 18:64027195-64027217 TTTCGGGAGGCGGAGGTGGGCGG - Intergenic
1159855516 18:73583049-73583071 CCGAGGGTGGAAGAGGTGGAAGG + Intergenic
1159995679 18:74961609-74961631 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1160103323 18:75944968-75944990 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1160161036 18:76471235-76471257 TTCCGTGTGGAGGATGTGGAGGG - Intronic
1160449460 18:78952362-78952384 TCTCAGGTGGCTGAGGTGGGAGG + Intergenic
1160584044 18:79903045-79903067 TCTCGGGTCCAGGGAGTGGAGGG - Exonic
1160625531 18:80201783-80201805 GCTGGGGTGAAGGAGGCGGAGGG + Intronic
1160927126 19:1552100-1552122 GCTCGGGAGGCTGAGGTGGAAGG - Intergenic
1160951290 19:1668886-1668908 TCCCGGGTGGAGGAGCAGGCAGG + Intergenic
1161008604 19:1949035-1949057 TCTCGGGTGGCAGAGCGGGAAGG + Intronic
1161021049 19:2011717-2011739 TCCGGGGTGGCAGAGGTGGAAGG - Intronic
1161151661 19:2713269-2713291 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151673 19:2713313-2713335 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151707 19:2713445-2713467 TTAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151762 19:2713665-2713687 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151787 19:2713753-2713775 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151812 19:2713841-2713863 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151836 19:2713929-2713951 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151848 19:2713973-2713995 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151874 19:2714061-2714083 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151911 19:2714193-2714215 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151950 19:2714325-2714347 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161220511 19:3116018-3116040 GCTGGGGTGGAGGAGCTGGGTGG + Intronic
1161418283 19:4160185-4160207 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1161639882 19:5415264-5415286 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1161821624 19:6533749-6533771 TCTCTGGAGGGGGAGGGGGAAGG - Intronic
1161938137 19:7384798-7384820 ACTCGGGAGGAGGAGGTGGGAGG - Intronic
1162199245 19:9009050-9009072 CCCCGGATGGAGGAGGTGGATGG + Intergenic
1162257095 19:9499281-9499303 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1162476245 19:10901423-10901445 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1162875758 19:13619783-13619805 TCTCGGGAGGCTGAGGTGGGAGG - Intronic
1163264610 19:16211639-16211661 ACTCGGGTGGCTGAGGTGGGAGG + Intronic
1163290814 19:16377917-16377939 TGTGGGGTGGAGGATGTGGATGG - Intronic
1163340937 19:16706615-16706637 GCTCGGGAGGCTGAGGTGGAAGG + Intergenic
1163346836 19:16748713-16748735 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1163428858 19:17254758-17254780 ACTCGGGTGGCTGAGGTGGGAGG - Intronic
1163538066 19:17889579-17889601 ACTCGGGAGGATGAGGTGGGAGG - Intronic
1163555545 19:17990373-17990395 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1163558287 19:18004889-18004911 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1163561949 19:18024508-18024530 ACTCAGGAGGATGAGGTGGAAGG - Intergenic
1163696853 19:18768580-18768602 ACGCGGGTGGAGGAGGCGGCGGG - Exonic
1163809833 19:19424030-19424052 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1164488609 19:28685449-28685471 TGTGGGGTGGGGGAGGGGGAGGG + Intergenic
1164738263 19:30558388-30558410 GCTGGGGTGGTGGGGGTGGAGGG + Intronic
1164769891 19:30800399-30800421 TCTCGGCTGAAGGAGGTGGAAGG - Intergenic
1164792378 19:30998360-30998382 TCTTAGGAGGATGAGGTGGAAGG + Intergenic
1164883995 19:31761419-31761441 TCCCGGCTGGGGGAGGGGGAAGG - Intergenic
1165034409 19:33022570-33022592 GCTGGGGGAGAGGAGGTGGAGGG - Intronic
1165038740 19:33053966-33053988 TCTCGGGAGGCTGAGGTGGGAGG - Intronic
1165065866 19:33227275-33227297 TCTCTGGGGCTGGAGGTGGAGGG - Intergenic
1165259426 19:34599232-34599254 TCTATGGTGGAGGAGTGGGATGG + Intronic
1165498377 19:36168223-36168245 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1165523699 19:36334045-36334067 ACTTGGGAGGCGGAGGTGGACGG - Intergenic
1166103818 19:40587793-40587815 TCTTGGGAGGCTGAGGTGGAGGG + Intronic
1166145788 19:40834268-40834290 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1166149892 19:40865162-40865184 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1166221680 19:41369005-41369027 ACTCTGGTGGCGGAGGTGGGAGG + Intronic
1166412189 19:42562822-42562844 ACTCGAGTGGCTGAGGTGGAAGG + Intergenic
1166519372 19:43469980-43470002 ACTCGGGAGGCCGAGGTGGAAGG + Intergenic
1166552590 19:43676355-43676377 TCTCTGGTTGGGGAGGTGGGGGG + Intergenic
1166700544 19:44879288-44879310 CCTCGGGTGGAGGTGGGGGTGGG + Intronic
1166756446 19:45195313-45195335 ACTCGGGTGGCTGAGGTGGGAGG - Intronic
1167176519 19:47868248-47868270 TCTCGGGAAGCCGAGGTGGAAGG + Intergenic
1167277378 19:48546489-48546511 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1167350616 19:48971968-48971990 TCTTGGGTGGCTGAGGTGGGAGG - Intronic
1167511211 19:49896182-49896204 TCTGGGGTGGAGGAGAAGGGAGG + Intronic
1167596442 19:50430803-50430825 TCCCAGGAGGAGGAGGAGGAAGG + Exonic
1167638756 19:50668884-50668906 TCTCGGGAGGATGAGGGGGGTGG + Exonic
1167693995 19:51003353-51003375 TCTCGGATGTTGGAGGAGGAAGG - Intronic
1168162144 19:54517962-54517984 TCGGGGGTGGGGGAGGGGGAGGG + Intergenic
1168435920 19:56316943-56316965 ACTCAGGTGGCGGAGGTGGGAGG - Intronic
1168715863 19:58526934-58526956 TCTCGGGAGACTGAGGTGGAAGG - Intronic
925611253 2:5705402-5705424 GCTGGGGTGGAGGAGCTGGGAGG + Intergenic
925611261 2:5705424-5705446 GCTGGGGTGGAGGAGCTGGGAGG + Intergenic
925611510 2:5706191-5706213 GCTGGGGTGGAGGAGCTGGGAGG + Intergenic
925611575 2:5706390-5706412 GCTGGGGTGGAGGAGCTGGGAGG + Intergenic
925611612 2:5706500-5706522 GCTGGGGTGGAGGAGCTGGGAGG + Intergenic
925671552 2:6315294-6315316 TCTTGGGTGGTGGAGGTGTAGGG - Intergenic
926055836 2:9773436-9773458 TCTCTGTTGGAGAAGGTCGAAGG + Intergenic
926055844 2:9773480-9773502 TGGCGGGTGCAGGAGCTGGAGGG - Intergenic
926165703 2:10521357-10521379 TCTTGGCTGGCAGAGGTGGAGGG - Intergenic
926223092 2:10948964-10948986 TCTTGGCTGGAGGAGTTGGGAGG + Intergenic
927024294 2:19049740-19049762 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
927569282 2:24144326-24144348 ACTCGGGAGGTGGAGGTGGGAGG + Intronic
927664689 2:25022576-25022598 ACTCGGGAGGATGAGGTGTAAGG + Intergenic
928023895 2:27724259-27724281 GCCTGGGTGCAGGAGGTGGAGGG - Intergenic
928088920 2:28362222-28362244 TCACGCGTGGAGGAGGAGGATGG - Intergenic
928120788 2:28582270-28582292 GGACGGGTGGAGGAAGTGGATGG + Intronic
928517990 2:32062107-32062129 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
928678442 2:33673804-33673826 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
929103724 2:38343037-38343059 TCTCGGGAGGCTGAGGTGGGAGG + Intronic
929492668 2:42409593-42409615 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
929621903 2:43363814-43363836 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
929949320 2:46394070-46394092 TCTAAGCAGGAGGAGGTGGACGG + Intergenic
930057425 2:47262780-47262802 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
930097490 2:47576950-47576972 TCTTGGGAGGATGAGGTGGGAGG - Intergenic
930151634 2:48066154-48066176 TCTGCTGTGGAGGAGGTGGGTGG + Intergenic
930213079 2:48663325-48663347 TCTCGGGAGGATGAGGTGGGAGG + Intronic
930410169 2:51015451-51015473 TCTTGGGTCGAGGAGAAGGAAGG + Intronic
931014806 2:57964429-57964451 TCAAGAGTGGTGGAGGTGGAAGG + Intronic
931033837 2:58214616-58214638 TCTCGGGAGGCTGAGGTGGGAGG - Intronic
931326137 2:61226068-61226090 ACTTGGGAGGATGAGGTGGATGG - Intronic
931737510 2:65210598-65210620 TCTCGGGAGGCTGAGGTGGGAGG - Intergenic
932255673 2:70283947-70283969 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
932629030 2:73322615-73322637 ACTCGGGTGGCTGAGGTGGGAGG - Intergenic
933105919 2:78325081-78325103 ACTCAGGAGGTGGAGGTGGAAGG - Intergenic
933412170 2:81940352-81940374 TCTCTTGTGGAGGGGGTGGGGGG - Intergenic
933859550 2:86451598-86451620 TCTCGGGTGACAGAGGTGGAAGG + Intronic
934708112 2:96498884-96498906 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
935508381 2:103937092-103937114 TCTCGGGAGGCTGAGGTGGGAGG + Intergenic
936487938 2:112942649-112942671 TCTCTGGAGGAGGAGGAGCAAGG - Intergenic
936788137 2:116119850-116119872 TGTCGGGTGGGGGAGGGGGGAGG - Intergenic
937368257 2:121280679-121280701 TCTTGGGTTGAGGAGGTCAAGGG + Intronic
937415836 2:121713851-121713873 TTTTGGGAGGTGGAGGTGGATGG - Intergenic
937557150 2:123172228-123172250 TCTTGGGAGGCTGAGGTGGAAGG + Intergenic
937940044 2:127278127-127278149 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
938905523 2:135832591-135832613 GCTCGGGAGGATGAGGTGGGAGG - Intronic
939606086 2:144255902-144255924 ACTGGGGTGGGGGAGGTTGATGG + Intronic
940476741 2:154171327-154171349 TTTCTGGTGGAGTAGGTAGAAGG - Intronic
940618637 2:156083520-156083542 GCTCCAGTGGAGGTGGTGGAGGG + Intergenic
940882169 2:158957898-158957920 TCTCGGGAGGCTGAGGTGGGAGG - Intergenic
941835863 2:170019882-170019904 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
942058560 2:172207116-172207138 TCTGGGGTGGAGGAGTAGGTGGG + Intergenic
942191295 2:173473213-173473235 TCTGGGCTGGGGGAGGGGGAAGG - Intergenic
942289402 2:174454544-174454566 TCTTGGGAGGATGAGGTGGGAGG + Intronic
942768548 2:179486805-179486827 TCTTGTGGGGAGGAGGTGGGTGG + Intronic
942904382 2:181163364-181163386 TCTCAGGAGGCTGAGGTGGAAGG + Intergenic
942965469 2:181888074-181888096 GCTGGGGTGGAGGAAGAGGAGGG + Intergenic
943234396 2:185299846-185299868 TCTGGGGTGGGTGAGATGGATGG + Intergenic
943354239 2:186831873-186831895 TGTGGGGTGGGGGAGGGGGAAGG + Intronic
944106667 2:196086277-196086299 TCTGGGGTGGGGGAAGTGAAGGG + Intergenic
944401988 2:199338257-199338279 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
944822050 2:203441032-203441054 TTGGGGGTGGAGGAGGGGGAGGG + Exonic
944908119 2:204283138-204283160 TGTCGGGTGGGGGAGGGGGGAGG - Intergenic
945096452 2:206223864-206223886 TCTCGGGAGGCTGAGGTGGGAGG + Intergenic
945143196 2:206709338-206709360 ACTCGGGAGGTTGAGGTGGAAGG + Intronic
945196290 2:207240404-207240426 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
945259792 2:207832791-207832813 TCTGGTGTGGGGGAGGTGCAGGG - Intronic
945958002 2:216104370-216104392 CCTCGGGAGGCTGAGGTGGAAGG + Intergenic
946174835 2:217916278-217916300 TCTGGAGGGGAGGAGGTGAATGG - Intronic
946201566 2:218073594-218073616 TCCTGGGTGGTTGAGGTGGAGGG + Intronic
946350534 2:219148448-219148470 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
946540991 2:220684489-220684511 TGGCGGGTGGAGTAGGTAGACGG + Intergenic
946597926 2:221326986-221327008 TCTCAGGAGGCTGAGGTGGAAGG + Intergenic
947035625 2:225851127-225851149 GCAGAGGTGGAGGAGGTGGAAGG + Intergenic
947573258 2:231251832-231251854 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
947814886 2:233030151-233030173 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
948458785 2:238119314-238119336 AGTTGGATGGAGGAGGTGGATGG + Intronic
948806500 2:240455523-240455545 TCTGGGTTGGAGGAGGAGAAAGG + Intronic
948861784 2:240756113-240756135 CCTTGGGTGGAGATGGTGGAAGG - Intronic
948947208 2:241226875-241226897 CCTCGGCTGGAGGAGGAGGAGGG - Intergenic
1168797750 20:622827-622849 TCTAGGGTGGACGGGGTGGGCGG - Intergenic
1168798394 20:627668-627690 TATCGGGTTGGGGAGTTGGAGGG - Intergenic
1169517407 20:6332909-6332931 TTTCTGGTGGAAGTGGTGGAGGG + Intergenic
1170591245 20:17773477-17773499 TATCTGGGGGAGGAGCTGGAAGG + Intergenic
1170644517 20:18185443-18185465 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1170732598 20:18987638-18987660 TCTTTGGTGGAGGAGGTGGATGG - Intergenic
1171042734 20:21780587-21780609 TCTATGGTGGTGGTGGTGGAAGG + Intergenic
1171165644 20:22967797-22967819 GTTCTGGTGGAGGTGGTGGAGGG - Intergenic
1172014491 20:31864886-31864908 TCTGTGGTGGGGGAGGGGGAGGG - Intronic
1172092200 20:32441243-32441265 ACTTGGGAGGATGAGGTGGAAGG - Intergenic
1172189772 20:33054853-33054875 TTTGGGGTGGAGGTGGGGGAAGG + Intergenic
1172414973 20:34757751-34757773 CCTGGGCTGGAGGAGGTTGAAGG + Exonic
1172615966 20:36284801-36284823 TCTCAGGAGGCTGAGGTGGAAGG - Intergenic
1172655782 20:36536905-36536927 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1172723503 20:37017262-37017284 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1172771938 20:37387003-37387025 TGGCAGGTGGAGGTGGTGGAAGG + Intronic
1172888742 20:38248981-38249003 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1173488556 20:43458860-43458882 GCTCGGGTGGAGGTGGGGTAGGG + Intronic
1173525540 20:43729777-43729799 ACTCGGGAGGATGAGGTGGGAGG + Intergenic
1173868441 20:46327651-46327673 CCTGGGGTGGAGGAGAAGGAAGG + Intergenic
1174041609 20:47704379-47704401 ACTCGGGAGGATGAGGTGGGAGG - Intronic
1174213954 20:48901824-48901846 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1174273573 20:49387076-49387098 TCTCTGGTGGAGGAGGAAGAGGG + Intronic
1174350873 20:49966754-49966776 TCTTGAGCTGAGGAGGTGGAGGG + Intergenic
1174809890 20:53636656-53636678 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1175389029 20:58614762-58614784 TCCAGGGTGGAGGAGGATGAAGG - Intergenic
1176224104 20:63985248-63985270 ACTTGGGTGGCTGAGGTGGAAGG + Intronic
1177787258 21:25684710-25684732 TCTTGGGTGGCTGAGGTGGGAGG - Intronic
1177851012 21:26348724-26348746 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1177995306 21:28089687-28089709 CTTCTGGTGGAGGTGGTGGAGGG + Intergenic
1178510514 21:33201605-33201627 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1178573180 21:33760023-33760045 ACCCGGGTGGAGGAGGTTGCAGG + Intronic
1178952760 21:36998700-36998722 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1178956633 21:37028478-37028500 ACTCGGGTGGCTGAGGTGGGAGG + Intergenic
1179281313 21:39936698-39936720 ACTCGGGAGGCTGAGGTGGATGG - Intergenic
1179906563 21:44426019-44426041 TCACAGCTGGAGGTGGTGGAGGG + Intronic
1180156502 21:45980052-45980074 ACTCGGGAGGCTGAGGTGGAGGG + Intergenic
1180661691 22:17473058-17473080 TTGAGGGTGGAGAAGGTGGAAGG + Intronic
1181017385 22:20079204-20079226 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1181528163 22:23501896-23501918 TGGCGGGTGGTGGAGGTGGCGGG - Intergenic
1181528172 22:23501922-23501944 TGGCGGGTGGAGGTGGTGGGTGG - Intergenic
1181571959 22:23772720-23772742 GCCCGGGTGGGGGAGGTGAACGG - Intronic
1181658238 22:24318818-24318840 ACTCGGGTGGCTGAGGTGGGAGG + Intronic
1181720993 22:24774375-24774397 TCATGGCTGGAGGAGGTGCATGG - Exonic
1182097072 22:27633212-27633234 TCTGGTGCGGAGCAGGTGGAGGG - Intergenic
1182218072 22:28735968-28735990 TTTCGGGTGGTGGAGGTAGGAGG + Intronic
1182250446 22:28995882-28995904 ACTCGGGTGGCTGAGGTGGGAGG - Intronic
1182341108 22:29621556-29621578 TCTCGGGAGGCTGAGGTGGGAGG + Intronic
1182495702 22:30705833-30705855 ACTGGAGTGGAGGAGGGGGAGGG + Intronic
1182520461 22:30881812-30881834 TCCGGGCTGGGGGAGGTGGACGG + Intronic
1182752150 22:32650373-32650395 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1182764004 22:32745393-32745415 TCGGGGGTGGAGGGGGTGGATGG + Intronic
1183074955 22:35421017-35421039 CCTCAGGTGGCTGAGGTGGAAGG + Intronic
1183122116 22:35738132-35738154 TCTCGGGAGGCTGAGGTGGGAGG + Intergenic
1183251217 22:36731807-36731829 ACTAGGGTGGAGGTGGTAGAAGG - Intergenic
1183290688 22:37000046-37000068 TCAAGGGAGGAGGAGTTGGAGGG - Intronic
1183344423 22:37299206-37299228 TCCCTGGGGGAGGAGGCGGAAGG - Exonic
1183446338 22:37858065-37858087 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1184113591 22:42409391-42409413 TGTCGGGTGGAGGGGCTGCATGG + Intronic
1184170907 22:42759242-42759264 TCTAGAGTGGAAGAGGAGGAAGG + Intergenic
1184367085 22:44058629-44058651 ACTCGGGAGGAGGAGGTTGCAGG - Intronic
1184426792 22:44413731-44413753 CCTCAGGAGGAGGAGGAGGAGGG + Intergenic
1185006177 22:48278231-48278253 TCTGGGTGGGAGGAGGGGGAAGG - Intergenic
1185367998 22:50445746-50445768 TGTGGGGTGGGGGAGGTGGCGGG + Exonic
1185383312 22:50520360-50520382 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
949447651 3:4152394-4152416 ACTCGGGTGGCTGAGGTGGGAGG - Intronic
949544869 3:5063777-5063799 ACTCGGGAGGCTGAGGTGGATGG + Intergenic
949983508 3:9519665-9519687 GCTCAGGAGGATGAGGTGGAAGG - Intronic
950066848 3:10118843-10118865 TCATGGGTGGCAGAGGTGGAAGG - Intronic
950067254 3:10122610-10122632 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
950106747 3:10393357-10393379 TTTTGGGTGGAGGGGGAGGAAGG + Intronic
950112373 3:10427650-10427672 TCTGGGATGGTGAAGGTGGAGGG + Intronic
950869481 3:16216388-16216410 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
951065717 3:18262869-18262891 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
951212423 3:19990252-19990274 TCTCGGGAGGCTGAGGTGGGAGG - Intronic
951758634 3:26119929-26119951 TCTCGGGAGGCTGAGGTGGGAGG - Intergenic
952845473 3:37684582-37684604 ACTCGGGAGGATGAGGTGGGAGG - Intronic
953172460 3:40519905-40519927 ACTCGGGAGGATGAGGTGGGAGG - Intergenic
953379607 3:42458392-42458414 GCAGGGGAGGAGGAGGTGGAAGG + Intergenic
953404766 3:42654772-42654794 GCCCGGGTGGAGGGGCTGGAGGG + Intronic
953442498 3:42930312-42930334 CCTCGGGAGGCTGAGGTGGAAGG + Intronic
953613505 3:44468669-44468691 CCTCGGGGGGAGGGGGTGGAGGG - Intronic
954055445 3:48019765-48019787 TCTTGGGAGGCTGAGGTGGACGG + Intronic
954159293 3:48708957-48708979 ACTCGGGAGGCAGAGGTGGAGGG + Intronic
954177384 3:48855335-48855357 TCTTGGGAGGTGGAGGTGGGAGG + Intergenic
954240528 3:49290011-49290033 ACTCAGGTGGATGAGGTGGGAGG + Intronic
954636996 3:52076393-52076415 TCTGGAGTGGAGGTGGTTGATGG - Intronic
954740117 3:52742896-52742918 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
955328903 3:58030763-58030785 ACTCGGGTGGCTGAGGTGGGAGG + Intronic
955456383 3:59126432-59126454 CTTCGGGAGGAGGAGGTGGGCGG - Intergenic
956111159 3:65871045-65871067 TCTCAGGAGGCTGAGGTGGAAGG - Intronic
956395549 3:68822578-68822600 ACTCGGGAGGCCGAGGTGGAAGG - Intronic
956618578 3:71198163-71198185 TCTTGGGAGGTGGAGGTGGTGGG - Intronic
957338135 3:78858746-78858768 GGTGGGGTGGGGGAGGTGGACGG - Intronic
957720966 3:83999438-83999460 TGTGGGGTGGGGGAGGTGGGAGG - Intergenic
958008411 3:87843670-87843692 TGTGGGGTGGGGGAGGGGGAGGG - Intergenic
958575555 3:95946415-95946437 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
959080386 3:101794692-101794714 TCTTGGGTAGAGAAGGAGGAAGG + Intronic
959083153 3:101823845-101823867 TCTCGGGAGGCTGAGGTGGGCGG + Exonic
959489179 3:106967123-106967145 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
959506644 3:107163958-107163980 ACTCAGGTGGCTGAGGTGGAAGG + Intergenic
959568605 3:107858248-107858270 ACTCGGGAGGATGAGGTGGGAGG - Intergenic
959597349 3:108142992-108143014 ATTCGGGAGGTGGAGGTGGAAGG - Intergenic
960663651 3:120088616-120088638 TGTGGGGTGGTGGTGGTGGAAGG - Intronic
960680639 3:120243924-120243946 GTTGGGGAGGAGGAGGTGGAGGG - Intronic
960803033 3:121557963-121557985 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
960893902 3:122480878-122480900 ACTTGGGAGGATGAGGTGGAAGG + Intronic
961225156 3:125237471-125237493 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
961544455 3:127622715-127622737 TCTCTGGGTGAGGTGGTGGATGG - Intergenic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962534701 3:136317328-136317350 ACTCGGGAGGCCGAGGTGGAAGG - Intronic
962642691 3:137404276-137404298 GCTCTGGTAGAGGAGGTGAAGGG - Intergenic
963606298 3:147413966-147413988 TCTCGGTTGGAGCGGGTGGGTGG + Exonic
964246466 3:154659705-154659727 TCTCAGGTGGTGGGGGTGGGAGG + Intergenic
964812997 3:160685826-160685848 TCTGGGGTGGTGGAGAGGGAGGG - Intergenic
964818699 3:160745957-160745979 TATCTGGTGGAGGTGGGGGATGG - Intergenic
965970462 3:174548947-174548969 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
966383129 3:179363598-179363620 ACTCTGGTGGCTGAGGTGGAAGG - Intronic
966482357 3:180425051-180425073 TGTGGGGTGGAGGAGGAGGGAGG - Intergenic
966772147 3:183513866-183513888 TGTCGGGTGGTGGAGGGGAAGGG - Intronic
967145178 3:186600274-186600296 TTTTGGGAGGAGGAGGTGGGCGG + Intergenic
967340781 3:188395325-188395347 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
967392313 3:188968694-188968716 TGTGGGGTGGGGGAGGGGGAAGG + Intronic
967501281 3:190201000-190201022 TCAGGGGTGGGGGTGGTGGAAGG + Intergenic
967926606 3:194653789-194653811 GCTTGGGTGGCGGAGGTGGGAGG + Intronic
967999189 3:195191239-195191261 GCAGAGGTGGAGGAGGTGGAAGG - Intronic
968571454 4:1344047-1344069 TTTTGGGTGGAGGGGGAGGAGGG + Intergenic
968780791 4:2579588-2579610 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
968798053 4:2722283-2722305 TCTCGGGTGCAGGTGGTGTGGGG + Intronic
969109978 4:4838533-4838555 TCTCGGGTACAGGAGGAGGGAGG - Intergenic
969209742 4:5677675-5677697 GCTCAGGAGGAGGAGGTGGCTGG - Intronic
969466556 4:7360689-7360711 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
969618722 4:8268402-8268424 TCTGGGGAGGATGAGGTGGGAGG - Intergenic
969681467 4:8645599-8645621 GCCCGGGTGGAGGTGGTGGGAGG + Intergenic
970115151 4:12686558-12686580 TTTTGGGTGGTCGAGGTGGAAGG + Intergenic
971237738 4:24857930-24857952 TTTGGAGTTGAGGAGGTGGAGGG - Intronic
972502802 4:39694040-39694062 ACTTGGGTGGTGGAGGTGGGAGG - Intergenic
972504498 4:39707628-39707650 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
972515984 4:39811110-39811132 ACTCGGGTGGCTGAGGTGGGAGG - Intergenic
972806267 4:42531991-42532013 ACTCGGGAGTATGAGGTGGAAGG + Intronic
973193862 4:47417438-47417460 TCTCGGGGGGAGGAGATGGGAGG - Intronic
973631927 4:52827431-52827453 TCTCGGGAGGCTGAGGTGGGAGG + Intergenic
974051416 4:56945615-56945637 TCTCAGGAGGTGGAGGTGGGAGG - Intergenic
974832928 4:67211397-67211419 TCAGGGGTGGAGGGGGTGGGGGG + Intergenic
975565854 4:75753607-75753629 TCTCGGGAGGCTGAGGTGGGAGG + Intronic
976252299 4:83064987-83065009 TCTGGGGAGGTGGAGGTAGAAGG - Intronic
977095247 4:92734388-92734410 TCTCAGGAGGCTGAGGTGGAAGG - Intronic
977099685 4:92795130-92795152 GAACAGGTGGAGGAGGTGGAAGG + Intronic
977264037 4:94833080-94833102 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
977694763 4:99952971-99952993 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
977715602 4:100180080-100180102 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
978221859 4:106286716-106286738 ACTAGGGTGGTTGAGGTGGAAGG + Intronic
978590695 4:110321961-110321983 TGTGGGGTGGGGGAGGTGGGAGG - Intergenic
978901535 4:113956056-113956078 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
979865010 4:125743581-125743603 ACTGGGGTGGAGGTGATGGAAGG - Intergenic
980032494 4:127846321-127846343 GCTGGGGTGGAGGAGGTGTTAGG - Intergenic
980916645 4:139039802-139039824 ACTCGGGAGGAGGAGGTTGCAGG - Intronic
981533580 4:145776350-145776372 ACTTGGGAGGAGGAGGTGGGAGG + Intronic
981550460 4:145937226-145937248 GCGCGGGTGGAGGAGGGGAAGGG + Intronic
981924554 4:150123929-150123951 ACTCGGGTGGCTGAGGTGGGAGG + Intronic
981956327 4:150478321-150478343 GGTTGTGTGGAGGAGGTGGAGGG - Intronic
982005416 4:151058505-151058527 ACTCGGGAGGATGAGGTGGGAGG + Intergenic
982117750 4:152112260-152112282 AATGGGGTGGAGGAGGAGGAGGG - Intergenic
982525046 4:156467378-156467400 CCTCGGGTGGGGGAGGGGGGAGG - Intergenic
982856542 4:160388994-160389016 TCTCGGGAGGCGGAGGTGGTTGG - Intergenic
983206279 4:164913377-164913399 TGTGGGGTGGGGGAGGGGGAGGG + Intergenic
983641951 4:169951510-169951532 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
984952405 4:185017245-185017267 TATCGGGGGGAGGAGGAGGGAGG - Intergenic
985565951 5:617422-617444 TCTTGGGAGGCCGAGGTGGATGG + Intronic
985777865 5:1854390-1854412 ACTTGGGAGGATGAGGTGGAAGG + Intergenic
985997884 5:3606756-3606778 TCTCGGGTGGGGCGGGAGGAGGG - Intergenic
986481053 5:8188744-8188766 TCTTGGGAGGCGGAGGTGGGCGG + Intergenic
986763167 5:10898385-10898407 GCAGAGGTGGAGGAGGTGGAAGG + Intergenic
987029781 5:13964986-13965008 TCCCCAGTGGACGAGGTGGAGGG - Intergenic
987309307 5:16667299-16667321 TCCCAGCTGGAGGAGGTGGCTGG - Intronic
988323468 5:29731394-29731416 ACTCGGGAGGCCGAGGTGGAAGG - Intergenic
988514475 5:31892674-31892696 ACTCGGGAGGATGAGGTGGGAGG - Intronic
988689173 5:33555351-33555373 ACTCGGGAGGCTGAGGTGGACGG - Intronic
989014944 5:36919440-36919462 ACTAGGGAGGATGAGGTGGAAGG - Intronic
989383944 5:40836099-40836121 ACTCAGGGGGTGGAGGTGGAGGG + Intergenic
989617835 5:43355267-43355289 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
989690355 5:44136169-44136191 TGTGGGGTGGAGGAGGGGGGAGG - Intergenic
989948480 5:50268584-50268606 TGTGGGGTGGGGGAGGGGGAGGG + Intergenic
990422912 5:55654494-55654516 ACTCGGGAGGTGGAGGTGGGAGG + Intronic
991960548 5:72039707-72039729 TATAGAGTGGAGGAGCTGGATGG - Intergenic
992062951 5:73074894-73074916 TGTTGGGTGGAGGAGGTGGTGGG + Intronic
992610996 5:78508492-78508514 TGTAGGGTGGAGGTGGGGGATGG - Intronic
992662322 5:78973944-78973966 TCTCTGGTGTATAAGGTGGAGGG - Intronic
992900122 5:81286437-81286459 ACTCGGGTGGCTGAGGTGGGAGG - Intergenic
993730078 5:91412230-91412252 TCTCAGGAGGCTGAGGTGGAAGG - Intergenic
994355673 5:98791791-98791813 TCTCTGGTACAGGTGGTGGAGGG - Intronic
994376956 5:99025885-99025907 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
994414625 5:99454080-99454102 TGTGGGGTGGAGGAGGGGGGAGG - Intergenic
995587395 5:113662336-113662358 ACTCGGGAGGATGAGGTGGAAGG - Intergenic
995697051 5:114891397-114891419 TGTGGGGTGGGGGAGGTTGAAGG - Intergenic
995870049 5:116734829-116734851 TCTGGGGTTGAGGAGCTGCAGGG + Intergenic
996117044 5:119630779-119630801 TCTGGGGTGACTGAGGTGGAAGG + Intronic
996432093 5:123392617-123392639 ACTCGGGAGGGTGAGGTGGAAGG - Intronic
996563706 5:124857651-124857673 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
996772836 5:127103243-127103265 TGTGGGGTGGGGGAGGTGGGAGG - Intergenic
997178085 5:131798681-131798703 ACTCGGGTGGCTGAGGTGGGAGG + Intergenic
997332970 5:133080304-133080326 ACTCGGGAGGCGGAGGTGGGAGG + Intronic
997531731 5:134585603-134585625 ACTCGGGTGGCTGAGGTGGGAGG + Intergenic
997556575 5:134804545-134804567 CCTCGGGTGGCTGAGGTGGGAGG - Intronic
997660292 5:135583939-135583961 TCTGGGGTGAAGGAAGTTGAAGG + Intergenic
997745830 5:136299374-136299396 TGTGTGGTGGAGGAGGAGGAGGG + Intronic
997925419 5:138026516-138026538 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
997958556 5:138300089-138300111 TCTCAGGAGGCGGAGGTGGAAGG + Intronic
999041641 5:148420229-148420251 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
999066518 5:148692720-148692742 TCTCAGGGGGATGAAGTGGAAGG + Intergenic
999694046 5:154172665-154172687 GCGAGGGTGCAGGAGGTGGAAGG + Intronic
1001586982 5:172839453-172839475 TCTTGGGAGGCTGAGGTGGAAGG + Intronic
1001856637 5:175016996-175017018 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1002097680 5:176840998-176841020 TCTCCGGTGAAGGAGGTGGATGG - Intronic
1002138485 5:177123560-177123582 ACTAGGGAGGATGAGGTGGAGGG + Intergenic
1002701677 5:181129121-181129143 ACTCAGGTGGCTGAGGTGGAAGG + Intergenic
1003493400 6:6642860-6642882 TCTCCGGAGGAGGAGGAGGGAGG - Intronic
1003514224 6:6804927-6804949 TCTGGGGAGGCTGAGGTGGAAGG - Intergenic
1004541884 6:16558481-16558503 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1004714300 6:18202288-18202310 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1004920558 6:20371599-20371621 ACTCGAGAGGAAGAGGTGGAAGG + Intergenic
1005294916 6:24416029-24416051 ACTTGGGTGGTGGAGGTGGGAGG - Intronic
1005463402 6:26089816-26089838 ACTCGGGAGGCTGAGGTGGAGGG + Intronic
1005513523 6:26533176-26533198 TTTCGCGTGGGGGAGGTGGGGGG + Intergenic
1005630124 6:27699449-27699471 TATCGGGTGGTGGATTTGGATGG + Intergenic
1005861926 6:29908444-29908466 GCTCGGGTGGAGGAGATGAAGGG - Intergenic
1005987172 6:30882598-30882620 TCTAGGCTGGAGGAGTGGGAGGG - Intronic
1006663528 6:35671153-35671175 ACTTGGGTGGCTGAGGTGGAAGG + Intronic
1006677856 6:35776930-35776952 GCACGGGCGGGGGAGGTGGAGGG - Intronic
1006755228 6:36409715-36409737 TCTCGGGAGGCTGAGGTGGGAGG + Intronic
1006829439 6:36959757-36959779 GCTCTGGAGGCGGAGGTGGAAGG + Intronic
1006980351 6:38142687-38142709 TAGAGGCTGGAGGAGGTGGAGGG + Intronic
1007634513 6:43290412-43290434 GCAGGGGTGGAGGAGATGGAGGG + Intergenic
1007892702 6:45310531-45310553 GTTCTGGTGGAGGTGGTGGAGGG - Intronic
1010211011 6:73363025-73363047 TCTTGGGAGGGGAAGGTGGAAGG - Intronic
1010303730 6:74291377-74291399 ACTCGGGTGGCTGAGGTGGGAGG - Intergenic
1011712837 6:90072002-90072024 GAAGGGGTGGAGGAGGTGGAAGG + Intronic
1012418087 6:99031717-99031739 TCGCGTGTAGAGGAGGTGGCTGG + Intergenic
1012707657 6:102552362-102552384 TGTGGGGTGGGGGAGGTGGGAGG + Intergenic
1012879996 6:104775274-104775296 ACTCGGGAGGCTGAGGTGGAGGG + Intronic
1012908445 6:105093531-105093553 TCTCGGGAGGCCGAGGTGGGAGG + Intergenic
1012922725 6:105235724-105235746 GTTCCGGTGGAGGTGGTGGAGGG - Intergenic
1013009917 6:106110641-106110663 ACTCGGGAGGATGAGGTGGGAGG - Intergenic
1013074108 6:106755257-106755279 TCCTGGGTGGAGGTGGTGGGAGG + Intergenic
1013270075 6:108537260-108537282 TCTAGTGTGGAGGTGGTGGGTGG + Intergenic
1013507553 6:110815188-110815210 TCGCGGGGGGAGGAGGAGGAGGG - Exonic
1013968003 6:115978942-115978964 ACTCGGGAGGATGAAGTGGAAGG + Intronic
1014041995 6:116838749-116838771 TCTGGGGTGGAGGAGGGGGGAGG + Intergenic
1014523144 6:122469799-122469821 ACTTGGGAGGATGAGGTGGATGG - Intronic
1015877921 6:137842757-137842779 GTTCTGGTGGAGGTGGTGGAGGG + Intergenic
1015998643 6:139020428-139020450 TCTCGGGAGGCTGAGGTGGGAGG - Intergenic
1016031952 6:139346956-139346978 CTTTGGGAGGAGGAGGTGGACGG + Intergenic
1016036534 6:139389290-139389312 ACTCGGGGGGCTGAGGTGGAAGG - Intergenic
1016106980 6:140175020-140175042 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1017159484 6:151351449-151351471 ACTCCGGTGCAGGAGGTGGAAGG + Exonic
1017268259 6:152476758-152476780 TCTCGGGAGGCTAAGGTGGAAGG + Intronic
1017434366 6:154402138-154402160 TCTTGGGCGGAGGTGGGGGAGGG - Exonic
1017621300 6:156301412-156301434 ACTTGGGTGGCTGAGGTGGAAGG + Intergenic
1018158203 6:161009858-161009880 TGTCGGGGGAAGGAGGTGGCGGG + Intronic
1018873725 6:167802540-167802562 TGGAGGGTGGGGGAGGTGGATGG + Intergenic
1018934764 6:168266460-168266482 TCTGGTGAGGAGGAGGTGAAAGG - Intergenic
1019116174 6:169764370-169764392 ACTCGGGGGGCGGAGGTGGGAGG - Intronic
1019400952 7:853538-853560 GCTCGGGTGGACCAGATGGAAGG + Exonic
1020032857 7:4945060-4945082 GGTCGGGGGGAGGAGGAGGAAGG - Intronic
1020158121 7:5744430-5744452 TCTTTGGTAGAGGAGGAGGAAGG + Intronic
1020169377 7:5833192-5833214 TCTCGGGAGGCTGAGGTGGGAGG + Intergenic
1020386971 7:7617100-7617122 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1020555923 7:9670208-9670230 CAATGGGTGGAGGAGGTGGAAGG + Intergenic
1020818353 7:12935141-12935163 TCTGGGATGGAGGAGTTGGGTGG + Intergenic
1020956663 7:14747299-14747321 ACTGGGGAGGATGAGGTGGAAGG - Intronic
1021000233 7:15320111-15320133 TGTGGGGTGGGGGAGGGGGAAGG + Intronic
1021107887 7:16659992-16660014 TGTGGGGTGGGGGAGGGGGAAGG - Intronic
1021311963 7:19107424-19107446 TCTGGGGCTTAGGAGGTGGAAGG + Intronic
1021506896 7:21395957-21395979 ACTTGGGTGACGGAGGTGGAAGG + Intergenic
1022010596 7:26304979-26305001 TCCCTGGAGGAGGGGGTGGATGG + Intronic
1022207762 7:28180257-28180279 GCTCGGGTGGGGGAGGGGGCGGG - Intronic
1022272307 7:28820710-28820732 ACTCAGGAGGCGGAGGTGGAAGG - Exonic
1022375075 7:29805666-29805688 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1022650523 7:32269880-32269902 ACTCGGGAGGTTGAGGTGGAAGG - Intronic
1022732818 7:33046428-33046450 TCTCAGGAGGCTGAGGTGGAAGG + Intronic
1022738197 7:33095939-33095961 ACTCGGGAGGATGAGGTGGGAGG - Intronic
1023769752 7:43545815-43545837 CTCGGGGTGGAGGAGGTGGAAGG + Intronic
1023813616 7:43931331-43931353 ACTCAGGTGGCTGAGGTGGAAGG + Intronic
1023892841 7:44405903-44405925 ACTCGGGAGGCTGAGGTGGAGGG - Intronic
1024143354 7:46484457-46484479 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1024298945 7:47870862-47870884 ACTTGGGAGGCGGAGGTGGAAGG + Intronic
1024953628 7:54892345-54892367 CCTGGGATGGAGGAGATGGAGGG - Intergenic
1025004560 7:55344126-55344148 TCCCGGGAGGAGGAGTTGGTGGG + Intergenic
1025995971 7:66527820-66527842 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1026321286 7:69269451-69269473 CCTTGGGTGGCTGAGGTGGAAGG + Intergenic
1026353668 7:69539191-69539213 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1026472425 7:70705629-70705651 TGTGGGGTGGAGGAGGCGAAGGG - Intronic
1026719646 7:72819539-72819561 ACTCGGGTGGCTGAGGTGGGAGG - Intronic
1027724323 7:81784927-81784949 TGTGGGGTGGGGGAGGGGGAAGG - Intergenic
1027792840 7:82654832-82654854 TGTGGGGTGGGGGAGGTGGGAGG + Intergenic
1028394135 7:90348633-90348655 GTGGGGGTGGAGGAGGTGGAAGG + Intronic
1028790823 7:94850882-94850904 TCTCGGGAGGATGAGGTGGGAGG + Intergenic
1029129732 7:98320963-98320985 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1029153838 7:98500888-98500910 TCACGTGTGGAAGAGGTGGAGGG + Intergenic
1029204390 7:98860229-98860251 GCTCGGGTCGTGGAGGAGGAAGG + Exonic
1029227143 7:99036367-99036389 ACTCGGGAGGCGGAGGTGGGAGG + Intronic
1029419979 7:100467381-100467403 TCAAGGGTGGAGGTGGTGGCAGG + Intronic
1029433634 7:100548742-100548764 TCATGGGAGGAGGAGGAGGAGGG - Intronic
1029622907 7:101701162-101701184 ACTCGGGAGGCGGAGGTGGGAGG - Intergenic
1029668740 7:102013811-102013833 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1029710699 7:102297788-102297810 TCTCGGGGGAAGGGGGTGGAGGG + Intronic
1030105676 7:105984948-105984970 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1030308726 7:108047307-108047329 GCAGGGGTGGAGGAGGTGGAAGG - Intronic
1031093788 7:117394211-117394233 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1031988830 7:128182480-128182502 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1032156553 7:129474247-129474269 ACTTGGGTGGCTGAGGTGGAAGG - Intronic
1032365631 7:131296843-131296865 TCTTGGGAGGCTGAGGTGGAAGG - Intronic
1032485301 7:132282490-132282512 ACTTGGGTGGCTGAGGTGGAAGG + Intronic
1032636618 7:133716001-133716023 ACTCTGCTGGAGAAGGTGGAAGG + Intronic
1032981995 7:137294608-137294630 TTTCTGGTGGCTGAGGTGGATGG - Intronic
1033162361 7:139008987-139009009 ACTCCAGTGGAGGAGGTGGGAGG + Intergenic
1033204085 7:139401861-139401883 TCTCGGGAGGCTGAGGCGGAAGG - Intronic
1033279554 7:139996075-139996097 ACTCGGGAGGCCGAGGTGGAAGG - Intronic
1033883690 7:145917937-145917959 TCTCAGGAGGCTGAGGTGGAAGG + Intergenic
1034320970 7:150181478-150181500 ACTCGGGTGGCTGAAGTGGAAGG + Intergenic
1034366876 7:150557859-150557881 TGTGGGGTGGGGGAGGGGGAGGG + Intergenic
1034488510 7:151380935-151380957 TCACTGGTGCAGGAAGTGGATGG - Intronic
1034507040 7:151500873-151500895 ACTGGGGAGGATGAGGTGGAAGG + Intronic
1034659551 7:152757697-152757719 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1035261015 7:157661693-157661715 TCCTGGGTGGAGGAGGTGTCTGG + Intronic
1035278074 7:157759860-157759882 TCTCTTGGGGAGGAGCTGGATGG + Intronic
1035944116 8:3940877-3940899 TCTCGGGGGGAGAAGGGAGATGG - Intronic
1036185916 8:6622268-6622290 TCTGGGGAGGAAGAGGTGGTAGG + Intronic
1036438150 8:8754904-8754926 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1037424201 8:18737431-18737453 TCTCGGGAGGCTGAGGTGGGAGG - Intronic
1037603962 8:20422102-20422124 TAGGGGCTGGAGGAGGTGGAGGG - Intergenic
1037845972 8:22282697-22282719 ACTCGGGTGGCTGAGGTGGGAGG - Intronic
1038044805 8:23757255-23757277 ACTCGGGAGGCTGAGGTGGAGGG - Intergenic
1038230647 8:25696286-25696308 TTTGGGGTGGAGGAGGTGGTGGG + Intergenic
1038412759 8:27371002-27371024 TCTTGGGAGGCTGAGGTGGAAGG - Intronic
1038934480 8:32233353-32233375 TTTTGGGAGGAGGAGGTGGGAGG - Intronic
1039140416 8:34381126-34381148 ACTCGGGTGGATGAGGTGGGAGG + Intergenic
1039553680 8:38461441-38461463 TCTCGGGAGGCTGAGGTGGGAGG - Intronic
1040045725 8:42961893-42961915 ACTCGGGAGGATGAGGTGGGAGG - Intronic
1040551664 8:48442498-48442520 TCTCGGGAGGAAGAGGTGAAAGG + Intergenic
1040986999 8:53306596-53306618 ACTCGGGGGGTTGAGGTGGAAGG + Intergenic
1041063808 8:54061671-54061693 ACTCAGGAGGATGAGGTGGAAGG + Intronic
1041256316 8:55982521-55982543 TCCTGGGTGGGGGAGGTAGAAGG - Intronic
1041353474 8:56973952-56973974 TCTCGGGTGGAGGAGGTGGAAGG - Intronic
1041625466 8:60020925-60020947 TGAGGGGTGGGGGAGGTGGAGGG - Intergenic
1041660622 8:60397764-60397786 TCGCTGGTGGAGGAGGAGAAAGG - Intergenic
1041720834 8:60973864-60973886 TCCTGGGTGGGGGAGGTGGAGGG + Intergenic
1041908911 8:63066964-63066986 ACTCGGGTGGCTGAGGTGGGGGG + Intronic
1042092883 8:65178272-65178294 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1042156922 8:65854151-65854173 ACTCCGGGGGAGGAGGTGGGAGG + Intergenic
1042414532 8:68504091-68504113 TCTAGGGCTGAGGAGTTGGAGGG - Intronic
1042529696 8:69802395-69802417 ACTCGGGAGGCGGAGGTGGGAGG + Intronic
1042553388 8:70013998-70014020 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1042600909 8:70498671-70498693 TCTCAGGAGGTTGAGGTGGAAGG + Intergenic
1042906077 8:73773614-73773636 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1043508020 8:80921924-80921946 TCTAGGGTGGCTGAGGTGGGAGG + Intergenic
1043665007 8:82799371-82799393 ACACAGGTGGAGGAGGTGAAAGG + Intergenic
1044461047 8:92444400-92444422 ACTCGGGAGGCGGAGGTGGGAGG - Intergenic
1044673021 8:94701967-94701989 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1044944961 8:97381197-97381219 TGTAGGCTGGGGGAGGTGGAAGG - Intergenic
1045010413 8:97953851-97953873 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1045962881 8:107989386-107989408 TTTTGGGTGGAGGAGGTAGAGGG - Intronic
1046378520 8:113420702-113420724 TTTCGGGAGGCGGAGGCGGATGG + Intronic
1046816193 8:118586449-118586471 ACTTGGGTGGCTGAGGTGGAAGG - Intronic
1046825481 8:118686655-118686677 CCTCGGGAGGCTGAGGTGGAAGG - Intergenic
1047425993 8:124747634-124747656 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1047731742 8:127734413-127734435 TCTCTTTTGGAGGTGGTGGAGGG + Intergenic
1047744413 8:127833560-127833582 ACTCGGGTGGCTGAGGTGGGAGG - Intergenic
1048794600 8:138138189-138138211 TCTCCTGTGGAGGAGGAGGAGGG - Intronic
1048844620 8:138594793-138594815 GCTGGGGTGGAGGAGGTAAATGG + Intronic
1049108562 8:140628658-140628680 TCTTGGGAGGTGGAGGTGGGAGG + Intronic
1049140330 8:140948987-140949009 TCTCGGGTGGCAAAAGTGGAAGG - Intronic
1049363603 8:142225863-142225885 TCTGGGATGGAGGAGTTGGCAGG + Intronic
1049709201 8:144056109-144056131 GCCAGGGTGGAGGATGTGGACGG - Intronic
1049785404 8:144448390-144448412 TCTGGGGTGGGGAAGGTGGGAGG - Intergenic
1049790701 8:144471417-144471439 ACTCGGGAGGCTGAGGTGGAAGG - Intronic
1049825364 8:144664231-144664253 ACTCAGGTGGCAGAGGTGGAGGG - Intergenic
1050534622 9:6621059-6621081 TCTTGGGAGGCTGAGGTGGAAGG + Intronic
1052839205 9:33277085-33277107 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1053752376 9:41269413-41269435 TCTCAGGTGGAGGAGTGGGTGGG - Intergenic
1054257904 9:62833745-62833767 TCTCAGGTGGAGGAGTGGGTGGG - Intergenic
1054715906 9:68557527-68557549 TCTTGGGAGGCTGAGGTGGAAGG + Intergenic
1054964824 9:71011887-71011909 GCTCGGGCGGCTGAGGTGGAAGG - Intronic
1055288182 9:74753585-74753607 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1055543259 9:77338082-77338104 ACTCGGGGGGCTGAGGTGGAAGG - Intronic
1055647227 9:78372700-78372722 TCTCGGATGGAAGAGTTGGTGGG - Intergenic
1055647764 9:78377062-78377084 CTTCGGGAGGATGAGGTGGATGG + Intergenic
1055709977 9:79050095-79050117 ACTTGGGAGGATGAGGTGGAAGG - Intergenic
1055912523 9:81368584-81368606 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1056322678 9:85451785-85451807 GATCTGGTGGAGGTGGTGGAGGG + Intergenic
1057025217 9:91730063-91730085 ACTTGGGTGGTGGAGGTGGGAGG - Intronic
1057225138 9:93289176-93289198 GCTCAGGTGCAGGAGGTGGCAGG - Exonic
1058079903 9:100690593-100690615 TCTGGGGTTTAGGATGTGGATGG + Intergenic
1058608339 9:106747699-106747721 TCTCTGGTGGTGGTGGTGGTGGG - Intergenic
1058702128 9:107609926-107609948 ACTCGGGAGGATGAGGTGGGAGG - Intergenic
1058855660 9:109059331-109059353 TGTAGGGTGGAGGGGGAGGAGGG - Intronic
1058958504 9:109971000-109971022 ACTCAGGTGGATGAGGTGGGAGG + Intronic
1059096944 9:111427049-111427071 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1059171325 9:112127909-112127931 CCTCGGGAGGCAGAGGTGGAAGG - Intronic
1059238783 9:112785322-112785344 ACTCGGGAGGATGAGGTGGGAGG - Intronic
1059540084 9:115121569-115121591 TCCCGGGAAGAGGAGGAGGAAGG - Intergenic
1060017865 9:120102605-120102627 TGTGGGGTGGGGGAGGTGGGAGG + Intergenic
1060512541 9:124244442-124244464 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1060749714 9:126161287-126161309 TCTCGGGAGGCTGAGGTGGGAGG - Intergenic
1061113986 9:128596797-128596819 ACTCGGGTGGCTGAGGTGGGAGG - Intronic
1061218256 9:129234553-129234575 GCACAGGTGGAGGATGTGGACGG - Intergenic
1061243542 9:129388867-129388889 TCTCGGGAGGCTGAGGTGGGAGG - Intergenic
1061256067 9:129454552-129454574 TGGTGGGTGGAGGAGGTGGTGGG + Intergenic
1061365428 9:130170535-130170557 ACTCGGGTGGCTGAAGTGGAAGG - Intergenic
1061579399 9:131527766-131527788 ACTCGGGTTGCTGAGGTGGAAGG + Intronic
1061685375 9:132272390-132272412 TTTTGGGTGGGTGAGGTGGAAGG - Intronic
1061693480 9:132354385-132354407 ACTCGGGGGGATGAGGCGGAAGG + Intronic
1061737399 9:132670653-132670675 TCTGGGGAGGAGGAGGGAGAGGG + Exonic
1061758914 9:132836178-132836200 TCTTGGGAGGCTGAGGTGGAAGG + Intronic
1061911258 9:133726257-133726279 ACTCGGGAGGTGGAGGTGGGAGG + Intronic
1061917175 9:133761378-133761400 TCTCGGGAGGGTGAGGTGGGAGG - Intergenic
1062648397 9:137562655-137562677 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1062653654 9:137590877-137590899 GCGCGGAAGGAGGAGGTGGACGG + Intergenic
1202800871 9_KI270719v1_random:174635-174657 TCTCAGGTGGAGGAGTGGGTGGG + Intergenic
1185824923 X:3240952-3240974 ACTTGGGAGGATGAGGTGGAAGG - Intergenic
1185865139 X:3617535-3617557 ACTCGGGAGGCGGAGGTGGGAGG + Intronic
1185923514 X:4120848-4120870 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1185927893 X:4167611-4167633 ACTCGGGTGGCTGAGGTGGGAGG - Intergenic
1185940201 X:4309392-4309414 TTGGGGGTGGAGGAGGTGGTGGG + Intergenic
1185979305 X:4758647-4758669 TCTCGGGAGGCTGAGGTGGGAGG + Intergenic
1186043526 X:5508330-5508352 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1186129719 X:6453739-6453761 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1186487811 X:9946946-9946968 TCCCCGGTGGAGGAGGGGCACGG + Exonic
1186583820 X:10850199-10850221 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1186780244 X:12904994-12905016 ACTCGGGTGGCTGAGGTGGGAGG - Intergenic
1186909021 X:14141713-14141735 TGTCGGGTGGGGGAGGGGGGAGG + Intergenic
1187050638 X:15692356-15692378 TCTCAGGAGGCTGAGGTGGAAGG - Intronic
1187061274 X:15789502-15789524 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1187071313 X:15891750-15891772 ACTCGGGAGGCAGAGGTGGAAGG + Intergenic
1187262860 X:17703187-17703209 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1187306761 X:18102202-18102224 TCTTTGGTGGGGGTGGTGGATGG - Intergenic
1187404815 X:18993570-18993592 ACTCGGGTGGCTGAGGTGGGAGG + Intronic
1187460347 X:19481004-19481026 ACTCGGGAGGTTGAGGTGGAAGG + Intronic
1187463403 X:19507466-19507488 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1187468478 X:19547041-19547063 ACTCGGGAGGCTGAGGTGGAAGG + Intronic
1187670069 X:21658274-21658296 TCCGGGGTGGACGAGGAGGACGG + Exonic
1189326797 X:40117329-40117351 TCTCGATTGGTGGAGGTGGTGGG - Intronic
1189413644 X:40794825-40794847 GTTCTGGTGGAGGTGGTGGAGGG - Intergenic
1189959746 X:46313004-46313026 ACTCGGGTGGCTGAGGTGGGAGG - Intergenic
1189993329 X:46614948-46614970 TCTCTAGAGGAGGAGATGGAAGG + Intronic
1190863431 X:54364459-54364481 GCTCGGGAGGCTGAGGTGGAAGG + Intergenic
1191188176 X:57635586-57635608 TTTGGGGTGGGGGAGGGGGAGGG + Intergenic
1192142389 X:68656856-68656878 TGTGGGGTGGAGGAGGGGGGAGG + Intronic
1192328264 X:70151767-70151789 TCTCGGGAGGCTGAGGTGGTAGG + Intronic
1192405669 X:70883475-70883497 ACTCGGGTGGTTGAGGTGGGAGG + Intronic
1192512664 X:71733530-71733552 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1192514033 X:71747979-71748001 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1192551964 X:72061710-72061732 TCTAGGGTGGAAGAGGTAGGGGG - Intergenic
1192808764 X:74531835-74531857 GCTCTGGGGGAGGAGGAGGATGG + Exonic
1192818062 X:74614714-74614736 CCGCGGGAGGAGGAGGGGGACGG + Intergenic
1192965556 X:76173327-76173349 CCTCGGGAGGATGAGGTGGGCGG - Intronic
1193420860 X:81280422-81280444 GGTCTGGTGGAGGAGGTGGAGGG - Intronic
1193904097 X:87221878-87221900 TGTGGGGTGGGGGAGGGGGAGGG + Intergenic
1193999433 X:88409647-88409669 ACTCGGGTGGAAGAGTGGGAGGG - Intergenic
1194558548 X:95393104-95393126 TCTGGGGTGGGGGAGGGGGGAGG + Intergenic
1194926868 X:99836241-99836263 GTTCTGGTGGAGGTGGTGGAGGG + Intergenic
1195061047 X:101195065-101195087 ACTTGGGAGGATGAGGTGGAAGG - Intergenic
1195636159 X:107118374-107118396 TCTCAGGTGGAGGTGGAGGTAGG + Intronic
1196864451 X:120058267-120058289 ACTCGGGAGGCTGAGGTGGAAGG + Intergenic
1196864852 X:120061537-120061559 ACTCAGGAGGATGAGGTGGAAGG + Intergenic
1196878249 X:120174795-120174817 ACTCAGGAGGATGAGGTGGAAGG - Intergenic
1197179282 X:123517031-123517053 TCTGGAGTGTAGGATGTGGAAGG + Intergenic
1197216493 X:123871587-123871609 ACTCGGGAGGATGAGGTGGGAGG - Intronic
1197993005 X:132338673-132338695 TGTGGGGTGGGGGAGGGGGAGGG - Intergenic
1198202851 X:134439295-134439317 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1198437724 X:136633345-136633367 ACTCGGGAGGCTGAGGTGGAAGG - Intergenic
1198455990 X:136818303-136818325 GCTGAGGTGGAAGAGGTGGAAGG + Intergenic
1198538344 X:137609012-137609034 TGGGGGGTGGGGGAGGTGGAAGG + Intergenic
1199687215 X:150275071-150275093 ACTCGGGTGGCTGAGGTGGGAGG - Intergenic
1200159522 X:153998971-153998993 TCTCGGGAGGCTGAGGTGGGAGG - Intergenic
1201534774 Y:15034424-15034446 TTTTGGGAGGATGAGGTGGAAGG + Intergenic
1201563384 Y:15342107-15342129 TGTGGGGTGGGGGAGGGGGAAGG - Intergenic
1201622830 Y:15979580-15979602 TCTCCTGTGGTGCAGGTGGATGG + Intergenic
1202087703 Y:21155983-21156005 TGTGGGGTGGAGGAGGAGGGAGG - Intergenic