ID: 1041355196

View in Genome Browser
Species Human (GRCh38)
Location 8:56993181-56993203
Sequence TCCAGGTGGGAGCCCACGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 205}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041355196_1041355209 22 Left 1041355196 8:56993181-56993203 CCGCCCGTGGGCTCCCACCTGGA 0: 1
1: 0
2: 1
3: 20
4: 205
Right 1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 65
1041355196_1041355205 -8 Left 1041355196 8:56993181-56993203 CCGCCCGTGGGCTCCCACCTGGA 0: 1
1: 0
2: 1
3: 20
4: 205
Right 1041355205 8:56993196-56993218 CACCTGGACGCTGGGGAAGGCGG 0: 1
1: 0
2: 2
3: 31
4: 457
1041355196_1041355208 18 Left 1041355196 8:56993181-56993203 CCGCCCGTGGGCTCCCACCTGGA 0: 1
1: 0
2: 1
3: 20
4: 205
Right 1041355208 8:56993222-56993244 TGAGCAGGTAGAACATCTTGCGG 0: 1
1: 0
2: 0
3: 12
4: 136
1041355196_1041355207 3 Left 1041355196 8:56993181-56993203 CCGCCCGTGGGCTCCCACCTGGA 0: 1
1: 0
2: 1
3: 20
4: 205
Right 1041355207 8:56993207-56993229 TGGGGAAGGCGGTCTTGAGCAGG 0: 1
1: 0
2: 0
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041355196 Original CRISPR TCCAGGTGGGAGCCCACGGG CGG (reversed) Exonic
900134136 1:1107047-1107069 GCTGTGTGGGAGCCCACGGGCGG - Intronic
900232106 1:1564723-1564745 TCCAGGGAGGACCACACGGGGGG + Intronic
900372102 1:2336699-2336721 ACAAGGTGGGTGCCCACGGGGGG - Exonic
900465247 1:2822221-2822243 TCCAGGTGCGAGTCAAGGGGAGG + Intergenic
901065084 1:6490611-6490633 TCCAGGTGGTAGCGCCCGCGCGG - Intronic
901440482 1:9275105-9275127 GCCAGGTGGGAGCCCACAGGAGG - Intergenic
901633927 1:10660968-10660990 GCTGGGTGGGAGCCCAGGGGTGG + Intronic
903190511 1:21653235-21653257 CCCAGGTGGGAGCCGAGAGGGGG - Intronic
903263382 1:22142987-22143009 TGCAGGTGGGCGCCCGCGGGCGG + Intronic
903338608 1:22640933-22640955 GCCAGGTGGAAGCCCAGGGCTGG - Intergenic
903999563 1:27331145-27331167 TCAAGGTGGGGGGACACGGGAGG + Intronic
904303768 1:29573765-29573787 TCCAGGTGGGAGGCAGTGGGTGG + Intergenic
904424015 1:30412096-30412118 TCCAGGTGAGAGGGCACAGGTGG - Intergenic
909782243 1:79561605-79561627 GCCACGTGGGAGCCCACCGCAGG + Intergenic
915234419 1:154470062-154470084 CCCAGGTGGGGGCCCAGAGGCGG - Intronic
920553446 1:206885142-206885164 TCCATGTGTGACCCCACTGGTGG - Intergenic
921676552 1:217982737-217982759 TCTAGTTGGGGGACCACGGGGGG + Intergenic
922468514 1:225861417-225861439 TCGAGGTGGGAGCCCTGAGGAGG - Intronic
924816736 1:247448547-247448569 TCCAGCTGGGGGCCCTCAGGTGG + Exonic
1062927207 10:1326336-1326358 TCCAGGTGGGCACCCATGGAGGG + Intronic
1062965130 10:1601290-1601312 GCCAGGTGGGCCCCCACTGGTGG + Intronic
1065293699 10:24255421-24255443 TCCAGTGCTGAGCCCACGGGTGG - Intronic
1065726994 10:28677000-28677022 TTCGGGTGGGAGCCCGGGGGAGG - Intergenic
1066411841 10:35178515-35178537 TCCAGGAGGGAGCCAGCGAGGGG - Intronic
1067083510 10:43226514-43226536 GTCAGGTGGGAGCCCATGGATGG - Intronic
1067828862 10:49598456-49598478 TCCAGATGGGAGACCAGGTGTGG - Intergenic
1067931582 10:50567528-50567550 GCCAGGTGGCAGCCCAAGTGGGG - Intronic
1071859943 10:89662172-89662194 CCCAGGTGGGAGGCCAAGGTGGG - Intergenic
1073562220 10:104506645-104506667 TCCATATGGGAGCCCCAGGGTGG + Intergenic
1075103527 10:119522346-119522368 TCCAGCAGGGAGACCATGGGAGG - Intronic
1076441253 10:130482761-130482783 ACCAGGTGGGAGTCCCGGGGAGG + Intergenic
1077104583 11:836652-836674 TCCAGGTGGGGGCTGAGGGGCGG - Intronic
1077389046 11:2290887-2290909 TACAGGTGGAAGCCCATGGGAGG - Intergenic
1077410514 11:2401777-2401799 TACAGGTGGAAGGCCACTGGAGG + Intronic
1077430030 11:2511797-2511819 TCCATGCAGGAGCCCAGGGGAGG + Intronic
1079131140 11:17747565-17747587 TCCTGTTGGGTGCCCATGGGCGG + Intronic
1083738835 11:64697120-64697142 TCCAGGTCGGAGGGCAAGGGTGG - Intronic
1084149761 11:67282601-67282623 TCCAGGTGGGATGCCAAAGGAGG + Intronic
1084361134 11:68669438-68669460 TCCGTGTGGGAGCGCACTGGGGG - Intergenic
1084705875 11:70815718-70815740 TCCCGGTGGGGGCCCTGGGGAGG + Intronic
1084957774 11:72700495-72700517 TCCTGGAGGGAGCCCACCTGCGG - Intronic
1085886912 11:80532813-80532835 GCCACGTGGGAGCCCACCGCAGG + Intergenic
1087638343 11:100728258-100728280 TGCAGGTGGGAGCACAGGTGTGG - Intronic
1095381995 12:41606122-41606144 TCCAGCTCACAGCCCACGGGAGG + Intergenic
1099318237 12:81111409-81111431 TCCAGGGGAGAGGCCACTGGTGG + Intronic
1100531680 12:95467323-95467345 TGCAGATGGTAGCCCAGGGGCGG + Intergenic
1104936453 12:132366834-132366856 TCCTGGTGGCAGGCCCCGGGGGG + Intergenic
1105611551 13:21973853-21973875 TCCACGGGGCAGCTCACGGGGGG - Intergenic
1105854404 13:24361779-24361801 GGAAGGCGGGAGCCCACGGGAGG + Intergenic
1109416413 13:62046612-62046634 GCCACGTGGGAGCCCACGGCTGG + Intergenic
1113530355 13:111020187-111020209 CCCAGGTGGGAGTCCACGCAGGG + Intergenic
1113961520 13:114128801-114128823 CCCAGCGGGGAGCCCACGGCAGG + Intronic
1118761913 14:68885297-68885319 TACAGGTGGGTGCCCAGGTGGGG - Intronic
1120169723 14:81236373-81236395 GCCACGTGGGAGCCCACAGGGGG - Intergenic
1121483217 14:94294050-94294072 TCCAATGTGGAGCCCACGGGAGG + Intergenic
1121664815 14:95664505-95664527 GCCATGTGGGAGCACACGAGGGG + Intergenic
1122347638 14:101070437-101070459 ACCAGGAGGAAGCACACGGGAGG + Intergenic
1122875977 14:104665554-104665576 TCCAGGAGGGACCCCAGGGCGGG + Intergenic
1122937987 14:104968636-104968658 TCCAGGTGGGAGGGCATGGTTGG + Intronic
1123058569 14:105584115-105584137 CACAGGTGGGAGCCCAGGAGGGG - Intergenic
1123082901 14:105704349-105704371 CACAGGTGGGAGCCCAGGAGGGG - Intergenic
1124149823 15:27167609-27167631 TCCAGGTGGGCGCCCTTGAGAGG - Intronic
1124414867 15:29466570-29466592 CCCAGGGGAGAGCCCAGGGGAGG + Intronic
1124971802 15:34495972-34495994 TCCAGGTGGGCTCCCCCGGGCGG + Intergenic
1125677550 15:41511077-41511099 TACAGGCCGGAGCCCTCGGGAGG - Intronic
1125921426 15:43527915-43527937 CCCAGGTGTGAGTCCAAGGGAGG - Exonic
1126778166 15:52117561-52117583 GCCCTGTGGCAGCCCACGGGAGG + Exonic
1127383474 15:58449075-58449097 CACAGGTGGGAGCCCAGGGGAGG + Intronic
1128548653 15:68583863-68583885 CCCGGGTGGGAGCCCACTTGCGG + Intronic
1129203757 15:74023076-74023098 GCCAGGTGGTAGCTCACGTGCGG + Exonic
1131870264 15:96756818-96756840 GCCGGGTGGGAGCCAGCGGGAGG + Intergenic
1132480903 16:165695-165717 GCCAGGAGGGAGCACATGGGAGG - Intronic
1132484412 16:183008-183030 TCCAAGAGGGGGCTCACGGGTGG - Intergenic
1132957294 16:2601696-2601718 TGAAGGTGGGGCCCCACGGGTGG - Exonic
1133275958 16:4638624-4638646 ACCAGGTGGGAGGCCAGAGGGGG - Intronic
1133489706 16:6255543-6255565 TACAGGTGGGTGCCAACAGGAGG + Intronic
1133569345 16:7025918-7025940 GCCAGGTGGGAGCTCCCGAGAGG - Intronic
1135657779 16:24266765-24266787 TCCAGGAGGCAGGCCACAGGTGG - Intronic
1136001454 16:27297304-27297326 TCCAGGTTGGAGTGCACTGGTGG + Intergenic
1136011073 16:27363647-27363669 TCCAGGTGGGGTTCCACTGGAGG + Exonic
1136141541 16:28292226-28292248 TCTAGGTCAGAGCCCACGAGGGG - Intergenic
1136479407 16:30532527-30532549 TACAGCTGGAAGCCCACAGGCGG + Exonic
1136483119 16:30555222-30555244 TACAGCTGGAAGCCCACGGGCGG + Exonic
1136540037 16:30923905-30923927 TCCAGGGGCGGGCCCAGGGGAGG + Intronic
1138273611 16:55714025-55714047 CCCAGGTGGGAGGCAAAGGGTGG + Intergenic
1138294346 16:55873805-55873827 ACCAGGTTCGGGCCCACGGGTGG - Intronic
1139150926 16:64381228-64381250 TCCAGGAGGGAGGCCAGGGGTGG + Intergenic
1141160639 16:81627398-81627420 TCCTGGTAGGAGCCCACGCGTGG + Intronic
1141507127 16:84485219-84485241 TCCAGGTGCCAGCCCAGGGCCGG - Intronic
1141649327 16:85384815-85384837 TCCAGGAGGGAACACACAGGAGG + Intergenic
1141709428 16:85689186-85689208 GCCAGGTGCACGCCCACGGGCGG - Intronic
1142260830 16:89041840-89041862 TCTAGGTGGGAGGCCCAGGGAGG - Intergenic
1142494576 17:299529-299551 TCCCTGTGGGAGGACACGGGGGG - Intronic
1144708995 17:17388229-17388251 GCCAGGAGGGAGCCCACAGGTGG - Intergenic
1145248564 17:21285127-21285149 TCCAGGTGAGGGCCCAGGCGGGG - Intronic
1146329487 17:31916307-31916329 TCCAGGTGGGAGTACAGTGGCGG + Intergenic
1148991290 17:51669063-51669085 GCCATGCGGGAGCCCACGGCGGG - Intronic
1150724233 17:67638465-67638487 TGCAGGTGGCAGCCCCCAGGAGG - Intronic
1151523273 17:74646304-74646326 TCCAGGTGTGAGACAACGGTGGG + Intergenic
1151571124 17:74925883-74925905 TCCAAGTGGGAGCTCACGTTGGG - Intronic
1151980256 17:77504310-77504332 TCCAGCAGGGAGCCCAGGTGAGG + Intergenic
1152759198 17:82099260-82099282 TCCAGGCGCGCACCCACGGGCGG + Intergenic
1152856421 17:82667287-82667309 GCCAAGTGGGAGGCCACCGGTGG - Intronic
1153953229 18:10074558-10074580 GCAAGGTGGGAGCACACAGGAGG - Intergenic
1160940637 19:1619015-1619037 TCAGGGTGGGAGCCCAGGGCAGG - Intronic
1160995914 19:1881850-1881872 TCCAGCTGGGCACCCCCGGGAGG + Intronic
1161645039 19:5448009-5448031 TCCAGGCAGGAGCCGATGGGTGG - Intergenic
1162433418 19:10642880-10642902 TCCCGGGGGGAGCCCAGGTGAGG + Intronic
1162894704 19:13758155-13758177 TCCAGGTGGAAGCACAGAGGTGG - Intronic
1163632521 19:18424645-18424667 TCCAGGTGGGAGACGGTGGGTGG + Intronic
1164981333 19:32616722-32616744 TCCAGGTGCCAGCCCAGGGCTGG + Intronic
1165080521 19:33303520-33303542 TTCAGGTGGGCGCCAACGGCGGG + Intergenic
1165798404 19:38532662-38532684 TCCAGGTGGCAGCTCTGGGGAGG - Exonic
1165912114 19:39235996-39236018 TACAGGTGTGAGCCAACTGGTGG + Intergenic
1166406125 19:42523101-42523123 TCCAGGTGAGGACCCACAGGTGG - Intronic
1166540840 19:43604658-43604680 CCGAGGTGGGAGCCCACTTGGGG - Intronic
1168554497 19:57326724-57326746 TCCAGGTAGGAGCCAACAGCTGG + Exonic
925367150 2:3318283-3318305 TCCAGGTTTCAGCCCACGAGGGG - Intronic
926679663 2:15653974-15653996 TCCATGTGGGAGCCCAGAGAAGG - Intergenic
932307728 2:70715792-70715814 TCAAGGTGGGATCCCATGGTGGG - Intronic
936049228 2:109210672-109210694 TCCAGGTGGGAGGCCCAGGAAGG + Intronic
938843005 2:135181173-135181195 TCCAGCTGGGAGCCCCCAGCTGG + Intronic
940207702 2:151222403-151222425 TACAGGTGTGAGCCCACGCCTGG + Intergenic
1174444755 20:50583020-50583042 TCCAGGAGGGAGCCCTGGGTGGG - Exonic
1175077998 20:56392150-56392172 CGCAGGTGGGAGCCGACGGGTGG - Exonic
1175891335 20:62317327-62317349 TCCAGGTGGGTGGCCAGGAGAGG - Exonic
1176293026 21:5056193-5056215 TCCAGGTGGCTGCCCAGGCGTGG - Intergenic
1176744699 21:10640886-10640908 TCCAGGTGGGACCCCAAAAGAGG - Intergenic
1177549140 21:22598078-22598100 GCCACGTGGGAGCCCATGGTGGG - Intergenic
1178311078 21:31530618-31530640 TCCAGGTGTGTGCCCACCAGGGG - Intronic
1179864234 21:44207457-44207479 TCCAGGTGGCTGCCCAGGCGTGG + Intergenic
1180758821 22:18183299-18183321 TCCTGGTGTGTGCCCAGGGGTGG - Intergenic
1180769108 22:18367090-18367112 TCCTGGTGTGTGCCCAGGGGTGG - Intergenic
1180777204 22:18495305-18495327 TCCTGGTGTGTGCCCAGGGGTGG + Intergenic
1180809924 22:18752614-18752636 TCCTGGTGTGTGCCCAGGGGTGG + Intergenic
1180826983 22:18870319-18870341 TCCTGGTGTGTGCCCAGGGGTGG - Intergenic
1181025414 22:20124731-20124753 GCCAGAAGGGAGCCCACTGGGGG - Intronic
1181196067 22:21186866-21186888 TCCTGGTGTGTGCCCAGGGGTGG + Intergenic
1181213460 22:21306258-21306280 TCCTGGTGTGTGCCCAGGGGTGG - Intergenic
1181480904 22:23198534-23198556 TCCTGGTGGGAGGCCACCGCAGG + Intronic
1181746076 22:24955733-24955755 TCCAGGTGAGAGGCCAGGCGCGG + Intronic
1184693626 22:46128327-46128349 CCCAGCTGGGACCCCAGGGGTGG + Intergenic
1185178745 22:49347361-49347383 TCTGGGTGGGGGCCCACAGGCGG + Intergenic
1185314746 22:50174197-50174219 CCCAGGTGGGAGGACAGGGGTGG + Intronic
1185382610 22:50517030-50517052 TGCTGGCGGGAGCACACGGGCGG + Intronic
1203230731 22_KI270731v1_random:107975-107997 TCCTGGTGTGTGCCCAGGGGTGG - Intergenic
1203277125 22_KI270734v1_random:96224-96246 TCCTGGTGTGTGCCCAGGGGTGG - Intergenic
949827191 3:8177824-8177846 TCCAGGTGTCAGACCACGGAGGG + Intergenic
950663914 3:14483326-14483348 TGCAGGTGGGAGCCCCTGAGGGG - Intronic
951551841 3:23882607-23882629 GCCACGTGGGAGCCCACTGCAGG + Intronic
952772630 3:37016449-37016471 TGCAGATGGTAGCCCAGGGGCGG + Intronic
953545288 3:43859900-43859922 TCCAGGCGGCAGCCCAGGGCAGG + Intergenic
954620673 3:51993678-51993700 TGCAGATGGTAGCCCAGGGGCGG + Exonic
957055009 3:75435961-75435983 CCCAGGAGCGAGCCCACGGTCGG + Intergenic
959323375 3:104906416-104906438 TCCACATGGGAGCCCACCGCGGG - Intergenic
961539485 3:127590222-127590244 TGGATGTGGGAACCCACGGGAGG - Intronic
961606630 3:128100302-128100324 CCCAGGTGTGAGCCCACTGCTGG + Intronic
961647881 3:128402061-128402083 TCCAGCTGGGAGCCCAGAGAAGG - Intronic
962873808 3:139520216-139520238 CCCAGGTGGGAGGCCTGGGGTGG - Intronic
968505182 4:968151-968173 TCCAGGTGGGTGCTCGGGGGCGG - Intronic
968623376 4:1614670-1614692 TCCTGGGGGCAGCCCAGGGGAGG + Intergenic
970134918 4:12912088-12912110 TCCAGAAGGGAGCCCAGGGTTGG - Intergenic
976412617 4:84733503-84733525 TCGAGGTGGGAGCCGATGGGAGG + Exonic
978390010 4:108215581-108215603 TCCAAGTGGGAGCCCGAGGAAGG + Intergenic
992048905 5:72925776-72925798 GCCACGTGGGAGCCCACTGGGGG - Intergenic
992763767 5:79975668-79975690 TCCAGGTGAAAGCCCTTGGGTGG - Intergenic
997918205 5:137950488-137950510 TCTAGGTGGAAGCCCACTGAAGG + Intronic
998370335 5:141656611-141656633 CCGACGTGAGAGCCCACGGGTGG - Exonic
1002080339 5:176733732-176733754 GCCACGTGGCAGCCCACGCGTGG + Intergenic
1006839059 6:37016457-37016479 TCCATGATGGAGCCCATGGGGGG + Intronic
1011043073 6:83052484-83052506 TTCAGGTAGGAGCCAACGAGGGG + Intronic
1018151056 6:160940098-160940120 TCCAGGTGGAAGCCCACTCAGGG - Intergenic
1019340968 7:508774-508796 CCCAGATGGGAGCCCCAGGGAGG + Intronic
1019517651 7:1446879-1446901 TCCTGGTGGCAGCCCACAGGTGG + Intronic
1023240548 7:38141662-38141684 TTCAGGTGTGAGCCAGCGGGTGG - Intergenic
1023285028 7:38609975-38609997 TACAGGTGGGATCCCTCAGGTGG - Intronic
1024030888 7:45458647-45458669 GCCTGGTGGGAGCCCAGGAGGGG + Intergenic
1024222053 7:47296748-47296770 TCCAGATGGTTGCCCAAGGGAGG + Intronic
1025258171 7:57399354-57399376 TCCAAGTGGGAGACCTGGGGAGG + Intergenic
1025709036 7:63890915-63890937 TCCAAGTGGGAGACCTGGGGAGG + Intergenic
1029521728 7:101067066-101067088 TCCTGGTGGGAGCCAAGGGCGGG + Intergenic
1029600737 7:101562039-101562061 TCCAGGTGGGCACCCTCAGGTGG + Intergenic
1035564188 8:630331-630353 TCCATGTGGGTGCTCACGGGAGG - Intronic
1035564242 8:630678-630700 TCCGTGTGGGTGCTCACGGGAGG - Intronic
1035564255 8:630756-630778 TCCGTGTGGGTGCTCACGGGAGG - Intronic
1035629485 8:1097103-1097125 TCAAGCTGGGAGCCCAGGGCAGG + Intergenic
1035629528 8:1097283-1097305 TCCAGCTGGGAGCCCGGGGCAGG + Intergenic
1035953047 8:4045123-4045145 TGCAGGTGGGAGGGCACAGGTGG - Intronic
1036645914 8:10611427-10611449 GCCAGGTGGGAGCCCGCAGGAGG - Exonic
1036825515 8:11972817-11972839 TCCAGGTGGGAACCCTGGAGTGG + Intergenic
1037890743 8:22622643-22622665 TCCAGGTTGGAGCAGATGGGAGG - Intronic
1041355196 8:56993181-56993203 TCCAGGTGGGAGCCCACGGGCGG - Exonic
1046521357 8:115330641-115330663 GCCAAGCGGGAGTCCACGGGAGG + Intergenic
1049006787 8:139860757-139860779 TCCATGTGAGGGCCCACGGACGG - Intronic
1049472733 8:142783562-142783584 ACCAGGTGGGTGCCCAGTGGAGG + Intergenic
1049746383 8:144264998-144265020 TCCAGGTCGTAGCCCACGTGGGG + Exonic
1051688750 9:19686526-19686548 TGCGGGAGGGAGCCCATGGGAGG + Intronic
1052122835 9:24738822-24738844 GCCATGTGGGAGCCCATGGGGGG - Intergenic
1053011884 9:34638159-34638181 TCAAGCTGGGAGCCCCAGGGTGG + Intronic
1055925661 9:81507654-81507676 GCCCCGTGGGAGCCCACTGGGGG - Intergenic
1056305805 9:85289334-85289356 GCCATGCAGGAGCCCACGGGTGG - Intergenic
1057496224 9:95563628-95563650 TCCACGAGGGAGCCCCAGGGAGG - Intergenic
1059313074 9:113401495-113401517 TGCAGGAGGGAGGCCACGAGGGG + Intergenic
1060888571 9:127173720-127173742 TCCAGTTGAGAGGCCACGTGCGG + Intronic
1061849360 9:133405370-133405392 TCCAGGTGGAAGCCCCCAGCTGG + Exonic
1062499162 9:136844958-136844980 TCCAGGCGGCAGCGCACGTGGGG - Exonic
1062607277 9:137353875-137353897 TCCACGTGGGAACCCACGCCGGG - Intronic
1062647815 9:137558352-137558374 CCCAGGTGGGAGCGCAGTGGTGG - Intronic
1185751007 X:2609499-2609521 TCCGGGTGGGAGGACGCGGGGGG + Intergenic
1190052163 X:47158366-47158388 TCCAGCTGGGTGGCCAGGGGTGG - Intronic
1190222464 X:48521206-48521228 TCCATCTGGGGGCCCACTGGTGG + Exonic
1193070530 X:77301248-77301270 TCCAGGTGGGTCCACACGGTTGG - Intergenic
1195072124 X:101291298-101291320 TCCGCGCGGGAGCCCACGCGCGG - Intronic
1197345804 X:125325060-125325082 GCCAGGGTGGAGCCCAGGGGTGG + Intergenic
1199188170 X:144940164-144940186 TCCAGGGGGGCTCCCAGGGGTGG + Intergenic
1200039180 X:153353520-153353542 TCCCGATGGGAGCCAACAGGAGG + Intronic
1200041835 X:153376250-153376272 TCCAAATTGGAGCCCACGGAGGG - Intergenic
1200827659 Y:7660440-7660462 GCCAGGTGGGAGCACAGGGGAGG + Intergenic
1200884468 Y:8254043-8254065 GCCAGGTGGGAGCTCAGGAGAGG + Intergenic
1200954074 Y:8927822-8927844 GCCAGGTGGGAGCTCAGGAGAGG - Intergenic
1200957903 Y:8970202-8970224 GCCAGGTGGGAGCTCAGGAGAGG - Intergenic
1200986412 Y:9306444-9306466 GCCAGGTGGGAGCTCAGGAGAGG + Intergenic
1202124167 Y:21554458-21554480 GCCAGGTGGGAGCTCAGGAGAGG - Intergenic
1202154841 Y:21874922-21874944 GCCAGGTGGGAGCTCAGGAGAGG + Intergenic
1202232190 Y:22669205-22669227 GCCAGGTGGGAGCTCAGGAGAGG - Intergenic
1202310966 Y:23526953-23526975 GCCAGGTGGGAGCTCAGGAGAGG + Intergenic
1202559836 Y:26143641-26143663 GCCAGGTGGGAGCTCAGGAGAGG - Intergenic