ID: 1041355197

View in Genome Browser
Species Human (GRCh38)
Location 8:56993184-56993206
Sequence GCGTCCAGGTGGGAGCCCAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041355197_1041355207 0 Left 1041355197 8:56993184-56993206 CCCGTGGGCTCCCACCTGGACGC 0: 1
1: 0
2: 2
3: 11
4: 169
Right 1041355207 8:56993207-56993229 TGGGGAAGGCGGTCTTGAGCAGG 0: 1
1: 0
2: 0
3: 12
4: 159
1041355197_1041355208 15 Left 1041355197 8:56993184-56993206 CCCGTGGGCTCCCACCTGGACGC 0: 1
1: 0
2: 2
3: 11
4: 169
Right 1041355208 8:56993222-56993244 TGAGCAGGTAGAACATCTTGCGG 0: 1
1: 0
2: 0
3: 12
4: 136
1041355197_1041355209 19 Left 1041355197 8:56993184-56993206 CCCGTGGGCTCCCACCTGGACGC 0: 1
1: 0
2: 2
3: 11
4: 169
Right 1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041355197 Original CRISPR GCGTCCAGGTGGGAGCCCAC GGG (reversed) Exonic
900186343 1:1334897-1334919 GAGGCCAGGTGGGGGCACACAGG + Exonic
900774551 1:4572345-4572367 AAGTCCAGGTGGGAGGCAACGGG + Intergenic
900902925 1:5528850-5528872 GGGGCCAGGTGGGAGGCGACTGG + Intergenic
901440483 1:9275108-9275130 GCAGCCAGGTGGGAGCCCACAGG - Intergenic
901873901 1:12155117-12155139 GGGTCTAGGTGGGAGACCTCTGG + Intergenic
902067499 1:13700325-13700347 GCGTCCCGGCGCGAGCCCAGAGG - Intronic
902640309 1:17762656-17762678 GGCTGCAGGTGGGAGCCCAGGGG + Intronic
902883273 1:19386897-19386919 GCTTACAGGTGTGAGCCCCCAGG + Intronic
903957888 1:27037668-27037690 GCTTCCATGTGGGAGCCACCTGG + Intergenic
904248695 1:29206747-29206769 GCAGCCAGGTAGGAACCCACAGG - Exonic
904424016 1:30412099-30412121 CCGTCCAGGTGAGAGGGCACAGG - Intergenic
905062419 1:35151037-35151059 TCGCCCAGGTTGGAGCGCACTGG + Intergenic
905578621 1:39066393-39066415 GCGTCCAGGCGGGAGTGCAGTGG + Intergenic
907497031 1:54852063-54852085 GCTTCCAGGGGGCAGCCCAGTGG - Exonic
910935493 1:92482849-92482871 GTCTCCAGGTAGGAACCCACTGG - Exonic
911126104 1:94342492-94342514 GAGCCCAGCTGGGAGCCCAAGGG - Intergenic
915557881 1:156670238-156670260 TCCCCCAGGTGGGACCCCACTGG - Exonic
922468515 1:225861420-225861442 GGGTCGAGGTGGGAGCCCTGAGG - Intronic
923561514 1:235045563-235045585 GCGTCCAGGGTAGAGCCCAGAGG + Intergenic
1063150491 10:3332219-3332241 GCTTCCAGGCGGGAGCCAGCTGG - Intergenic
1064384329 10:14877920-14877942 GAGACCAGGTGGGAGGCCCCTGG + Intergenic
1064412714 10:15121342-15121364 GCCCCCAGGTGGAAGCCCAAGGG + Intronic
1069660573 10:70121003-70121025 GCCTGCAGCTGGGAGGCCACGGG - Intronic
1070111784 10:73494324-73494346 TCGTCCAGGTTGGAGCACACTGG + Intronic
1070305661 10:75237755-75237777 TCGTCCAGGCTGGAGCCCAGTGG + Intergenic
1070389337 10:75955373-75955395 GATTCCAGGTGAGAGCCCAGAGG - Intronic
1070754811 10:78985464-78985486 GCGTCCTAGGGGGAGCCCAGGGG - Intergenic
1070849085 10:79548414-79548436 GTGTACAGATGGGAGACCACAGG + Intergenic
1070920081 10:80179088-80179110 GGGGCCAGGTGGGAGCTGACTGG + Intronic
1073317549 10:102593530-102593552 ACCTCCAGTTGGGAGACCACAGG - Intronic
1075468027 10:122666054-122666076 GCTCCCAGGCGGGAGCCCAGAGG - Intergenic
1076328986 10:129651178-129651200 GCCTCCGGGTCGGGGCCCACTGG - Intronic
1076356583 10:129857841-129857863 GTGTCCAGGTAGGAGAACACTGG + Intronic
1076791806 10:132780779-132780801 GGGTCCAGTTGGGAGCTGACTGG - Intronic
1077027181 11:446079-446101 GCGCCCAGGTGAAATCCCACAGG + Intergenic
1077454837 11:2672297-2672319 GGCTCCAGGTGGGAGCTCAAGGG + Intronic
1077462551 11:2717879-2717901 GCCTCCAGGTTTGAGCCCCCCGG + Intronic
1078101990 11:8335329-8335351 GAGTAGAGGTGGGAGCCCTCGGG - Intergenic
1081046363 11:38278674-38278696 CCGGCCAGGCCGGAGCCCACTGG + Intergenic
1083871554 11:65491268-65491290 GCTTCCAGGAGAAAGCCCACAGG + Intergenic
1084117376 11:67050116-67050138 GCTTCTGGGTGGGAGCCCCCAGG - Exonic
1088593291 11:111421494-111421516 GTAGCCAGATGGGAGCCCACAGG - Intronic
1089497297 11:118914193-118914215 GAGGCCAGGTGAGGGCCCACAGG - Intronic
1090327766 11:125904155-125904177 CCCTCCAGGCGGGAGCCCCCCGG - Intronic
1091587570 12:1824929-1824951 GTGTCCAGGAGGAAGCCCAAGGG + Intronic
1094537854 12:31337724-31337746 TCGTCCAGGTTGGAGCGCAGTGG - Intergenic
1095088764 12:38085464-38085486 GTGTCCAGGTGAGAGCCCAATGG - Intergenic
1102224100 12:111215823-111215845 GAGGCCATGTGGGAGCCCCCAGG + Intronic
1104446051 12:128834466-128834488 TTGTCCAGGTTGGAGCACACTGG - Intergenic
1104635522 12:130435983-130436005 GGGTCCCGGTGAGACCCCACAGG + Intronic
1113799231 13:113077950-113077972 TCTCCCAGGTCGGAGCCCACAGG + Intronic
1116041139 14:39687597-39687619 GCATGCAGGTGGGAGCTCAGTGG + Intergenic
1120169726 14:81236376-81236398 CAGGCCACGTGGGAGCCCACAGG - Intergenic
1122883352 14:104699892-104699914 GCCTCCTGGAAGGAGCCCACTGG + Intronic
1122937396 14:104966521-104966543 GCGTCCAGGTGGGAGCAGCAGGG - Intronic
1125619431 15:41046655-41046677 TTGTCCAGGTGGGAGCGCAGTGG + Intronic
1126023737 15:44426829-44426851 GGTCGCAGGTGGGAGCCCACTGG + Intergenic
1129882470 15:79016485-79016507 GGGTCAAGGTGGGAGTCCTCTGG - Intronic
1131230697 15:90656893-90656915 TCGCCCAGGTTGGAGTCCACTGG + Intergenic
1132935440 16:2478176-2478198 GCTTGCAGGTGTGAGCCCCCGGG - Intronic
1133155665 16:3873766-3873788 GTGGCCGGGTGGGAGCCCATGGG + Intronic
1133732650 16:8590019-8590041 GCGTGCAGGTCGGAGCCGGCAGG - Intergenic
1135256139 16:20942946-20942968 TCGTCCAGGTGGGAGTGCAAAGG + Intronic
1136483118 16:30555219-30555241 GGGTACAGCTGGAAGCCCACGGG + Exonic
1138598828 16:58043311-58043333 GCCATCTGGTGGGAGCCCACAGG + Exonic
1139150925 16:64381225-64381247 GAGTCCAGGAGGGAGGCCAGGGG + Intergenic
1139605503 16:68015350-68015372 TCGTCCAGGTTGGAGCACACTGG - Intronic
1141655906 16:85416443-85416465 CCGAGCAGGTGGGAGTCCACCGG + Intergenic
1142020430 16:87778972-87778994 GCGGCCAGGTAGGAGCCCCCAGG - Intergenic
1142216770 16:88833961-88833983 GCGTCGAGGTGGGCCCCCCCGGG + Intronic
1143181842 17:4988228-4988250 GGGTTGAGATGGGAGCCCACGGG + Exonic
1143529780 17:7496085-7496107 GGGGCCAGGTGGGATCCCAAAGG + Intronic
1144708996 17:17388232-17388254 GCAGCCAGGAGGGAGCCCACAGG - Intergenic
1145866987 17:28247846-28247868 GTGCCCAGGTGCCAGCCCACCGG - Intergenic
1147865148 17:43546776-43546798 GCGCCCAGGAGGGAGGCGACCGG + Intronic
1148168525 17:45501082-45501104 GGGTGAAGGTGGGAGCGCACGGG - Intergenic
1148280287 17:46341858-46341880 GGGTGAAGGTGGGAGCGCACGGG + Intronic
1148302515 17:46559795-46559817 GGGTGAAGGTGGGAGCGCACGGG + Intronic
1148611455 17:48967397-48967419 TCGTCCAGGTGGGAGTGCAGTGG + Intronic
1148852584 17:50561984-50562006 GCGTCCAGCTGCGAGCCAGCGGG - Intronic
1150399719 17:64847533-64847555 GGGTGAAGGTGGGAGCGCACGGG - Intergenic
1150855514 17:68748556-68748578 GAGACCAGGTGGGAGACAACTGG + Intergenic
1151679689 17:75616778-75616800 CCATCCAGGTGGGCCCCCACGGG + Intergenic
1152319524 17:79600676-79600698 CCTTCGAGGTGGGAGCCCCCTGG - Intergenic
1152572767 17:81127777-81127799 CCCTACAGGTGGGAGGCCACCGG - Exonic
1153347603 18:4044867-4044889 GCGGCCTGGTGGGAGGCGACTGG + Intronic
1157753677 18:50199433-50199455 GCTTCCAGATGGGAGCCCAAAGG - Intergenic
1160563749 18:79774337-79774359 TCGCCCAGGTGGGGGCCCACTGG - Intergenic
1160796089 19:946075-946097 GCGTCCAGGTGGGAGCATGAGGG + Intronic
1160904204 19:1444979-1445001 CCGTCCAGGGGGGAGGCCGCGGG - Intergenic
1162033003 19:7925462-7925484 GCGTCCAGGCCCGCGCCCACCGG + Exonic
1163673528 19:18643403-18643425 TCGCCCAGGTGGGAGCGCAGTGG - Intronic
1165940576 19:39413068-39413090 CCCTCCAGGTGGGAGCACAGGGG - Exonic
1167278243 19:48551902-48551924 GGCTCCAGGTGGGTGCCCACAGG + Intergenic
925208507 2:2027005-2027027 GCGTCCAGGCGGGGGCACATCGG + Intronic
925227357 2:2195307-2195329 GCTTCCAGTTGGGATCCCATAGG + Intronic
927729060 2:25454108-25454130 TCGTCCAGGTTGGAGCGCAGTGG - Intronic
928170135 2:28998203-28998225 GCTTCCAGGCGGGAGCACCCGGG - Exonic
933918691 2:87022806-87022828 GAGTAGAGGTGGGAGCCCAATGG + Intergenic
934004304 2:87747109-87747131 GAGTAGAGGTGGGAGCCCAATGG - Intergenic
935767264 2:106381123-106381145 GAGTAGAGGTGGGAGCCCAGTGG - Intergenic
938797668 2:134731861-134731883 CAGTCAAGGTGGCAGCCCACTGG - Intergenic
942165708 2:173238709-173238731 AGGGCCAGGTGGGAGGCCACAGG - Intronic
944279038 2:197873269-197873291 GCTTCTAGGTGGGAGCCTGCAGG + Intronic
945181241 2:207093404-207093426 GCCTCGAGGTGGGAGCCTGCAGG - Intronic
947679178 2:232014110-232014132 GCATCCAGGTGGAAGGCCAGGGG + Intronic
948667282 2:239544618-239544640 GAGTCCATGTGGGAGCCCAGTGG - Intergenic
948729163 2:239952465-239952487 GCCTGCAGGTGAGTGCCCACCGG - Intronic
1169079925 20:2791584-2791606 TCGTCCAGGCTGGAGCGCACTGG - Intergenic
1169392979 20:5205062-5205084 GGGGCCAGGAGGGAGCCCTCTGG + Intergenic
1169475124 20:5924029-5924051 GCCTCCTGGTGGGTGCTCACCGG - Exonic
1170744860 20:19090374-19090396 AGGTCCAGGTGGCAGCACACTGG - Intergenic
1172501985 20:35434087-35434109 GGCTCCAGGTGGGAGCGCAATGG + Exonic
1172667162 20:36608282-36608304 TTGCCCAGGTGGGAGCACACTGG + Intronic
1173924501 20:46770783-46770805 GCTTCCAGGTGGGACCCGGCAGG + Intergenic
1174349231 20:49955249-49955271 GCCTTAAGGTGGGAGCCCATGGG + Intergenic
1176294768 21:5065591-5065613 GCTTCCTGGTGGGAGGACACAGG - Intergenic
1178787364 21:35666269-35666291 TCATCCAGGAGGGAGCCCAGTGG + Intronic
1179862282 21:44196535-44196557 GCTTCCTGGTGGGAGGACACAGG + Intergenic
1180146623 21:45923635-45923657 GCATCCAGTTGGAAGCCCAGGGG + Intronic
1184943401 22:47784490-47784512 GCTTTCAGTTTGGAGCCCACAGG - Intergenic
1185046173 22:48529684-48529706 GTGTCCAGGTGGGATTCCAGGGG + Intronic
1185243531 22:49760445-49760467 GCCTCCAGGTGGGAGTCTCCTGG + Intergenic
952931918 3:38367105-38367127 GGGTCCAGGTGGGAGCACTGGGG + Intronic
953125240 3:40086492-40086514 GAGTCCAGGTGAGAGCCACCAGG + Intronic
954894973 3:53967431-53967453 GCCTCTGGGTGGGAGGCCACAGG - Intergenic
956450525 3:69370440-69370462 GTGTCCTTGAGGGAGCCCACTGG + Intronic
959262900 3:104103464-104103486 GAGTACGGGTGGGAGCTCACAGG + Intergenic
960921813 3:122754830-122754852 GCCTCCAGGTGTGGGCCAACGGG - Intronic
962939252 3:140110764-140110786 GCTTCCAGGTGGGCACCCAGAGG - Intronic
966918769 3:184599048-184599070 GGAACCAGGTGGGAGCCCAGAGG + Intronic
968728456 4:2259002-2259024 GTGTCCAGGCAGGACCCCACAGG + Intronic
969131381 4:4993371-4993393 TAGTCCAGGTGAGAGCCCATGGG - Intergenic
969186563 4:5478931-5478953 ACGCCCAGCTGGCAGCCCACAGG + Intronic
970071241 4:12162201-12162223 GGGTCCAGAAGGGAACCCACTGG - Intergenic
984701353 4:182820652-182820674 GGGGCCATGAGGGAGCCCACTGG - Intergenic
985887201 5:2688861-2688883 GCGTCTGGGCGGAAGCCCACAGG + Intergenic
986192541 5:5510333-5510355 GGGTCCAGGTGATAGCCGACCGG - Intergenic
986709816 5:10480548-10480570 GGGTCCAGGTGGGAGCCGTATGG + Intergenic
987741733 5:21917236-21917258 GCGGCCAGGTCAGAGCCCATTGG - Intronic
988500181 5:31777404-31777426 CCGGACACGTGGGAGCCCACGGG - Intronic
992048908 5:72925779-72925801 CAGGCCACGTGGGAGCCCACTGG - Intergenic
999216542 5:149940407-149940429 GCGCCCATGTGGGAGCCCACCGG + Intronic
1001678793 5:173540681-173540703 GGGTCCTGGTGGGAGGCGACTGG + Intergenic
1002373774 5:178774430-178774452 GGGTCCTGGTGGGAGCCCCAGGG - Intergenic
1007255085 6:40522766-40522788 GCATCTATGTGGGACCCCACAGG + Intronic
1010169951 6:72962744-72962766 GCATCCAGTTGTGAGGCCACTGG + Intronic
1011549008 6:88511969-88511991 GAGTCCAGGAGGCAGCCGACTGG + Intergenic
1016941851 6:149488864-149488886 GGGTCCAGGTGGGGACCCCCTGG + Intergenic
1017730332 6:157310401-157310423 GAGGCCAGGTGAGTGCCCACTGG - Intronic
1018128089 6:160701255-160701277 GAGTAGAGGTGGGAGCCCAATGG - Intergenic
1018148359 6:160915116-160915138 GAGTAGAGGTGGGAGCCCAGTGG + Intergenic
1018465975 6:164045373-164045395 GCGGCCTGGTGGGAGGTCACTGG - Intergenic
1018902302 6:168057756-168057778 CCGTCCAGGTGGGCGGCCAGCGG + Intronic
1018981483 6:168605024-168605046 GAGTCCAGGTGGGAGCCGAGGGG + Intronic
1019517649 7:1446876-1446898 CCCTCCTGGTGGCAGCCCACAGG + Intronic
1019789647 7:3002776-3002798 GGGTCCTGGTGGGAGGCGACTGG - Intronic
1026995356 7:74612482-74612504 GCCTCCAGGAGGAAACCCACAGG + Intergenic
1027393002 7:77724463-77724485 TTGTCCAGGTGGGAGTACACTGG + Intronic
1028162196 7:87498470-87498492 GCGTCCAGCTCGGGGCCCTCAGG + Intergenic
1029603811 7:101586243-101586265 TCTTCCAGGCGGGAGCTCACAGG - Intergenic
1032262196 7:130346817-130346839 GAGTCCAGGAGGAAGCCCCCGGG + Intronic
1036645915 8:10611430-10611452 GGGGCCAGGTGGGAGCCCGCAGG - Exonic
1036701098 8:11014507-11014529 GCCTCCAGGAGGGAACCCATAGG - Intronic
1038442329 8:27580019-27580041 GCCTCCCTGTGGGAGGCCACAGG - Intergenic
1040001656 8:42582256-42582278 TCGTCCAGGCTGGAGCCCAGTGG + Intergenic
1040433938 8:47371326-47371348 ACAGCCAGGTTGGAGCCCACTGG + Intronic
1041355197 8:56993184-56993206 GCGTCCAGGTGGGAGCCCACGGG - Exonic
1043162110 8:76858551-76858573 GCGCTCAGGTGGGGCCCCACTGG - Intronic
1045021108 8:98045266-98045288 GCGGGCAGATGTGAGCCCACGGG - Intronic
1045481703 8:102597971-102597993 GGGACCAGGTGGGAGGCGACTGG - Intergenic
1049473913 8:142788175-142788197 GGGTGCAGGCGGGAGCCCCCTGG + Intergenic
1051410675 9:16786720-16786742 GAGTCCTGCTGGGAACCCACAGG + Intronic
1052997581 9:34559452-34559474 GGGTCCAGCTGAGACCCCACAGG + Intronic
1057496225 9:95563631-95563653 GCGTCCACGAGGGAGCCCCAGGG - Intergenic
1060526173 9:124322535-124322557 GCCTCTAGGTGGAAGCCCCCAGG + Intronic
1061931286 9:133834390-133834412 GGGTCCAGCTGGGGTCCCACTGG - Intronic
1062018487 9:134304414-134304436 GGGTCCAGCTGGGAGACCAGGGG - Intergenic
1062320364 9:135987922-135987944 GGGTCCCCCTGGGAGCCCACAGG + Intergenic
1062581528 9:137231126-137231148 GGGTCCAGGTGGGGGGCCCCAGG + Intronic
1187362055 X:18637520-18637542 TCGTCCAGGTGGGAGTGCAGTGG - Intronic
1189334052 X:40159384-40159406 TCGTCCAGGTTGGAGTGCACTGG + Intronic
1201387396 Y:13456586-13456608 TCGTCCAGGTGGGGGTGCACTGG - Intronic