ID: 1041355198

View in Genome Browser
Species Human (GRCh38)
Location 8:56993185-56993207
Sequence AGCGTCCAGGTGGGAGCCCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041355198_1041355208 14 Left 1041355198 8:56993185-56993207 CCGTGGGCTCCCACCTGGACGCT 0: 1
1: 0
2: 1
3: 25
4: 190
Right 1041355208 8:56993222-56993244 TGAGCAGGTAGAACATCTTGCGG 0: 1
1: 0
2: 0
3: 12
4: 136
1041355198_1041355209 18 Left 1041355198 8:56993185-56993207 CCGTGGGCTCCCACCTGGACGCT 0: 1
1: 0
2: 1
3: 25
4: 190
Right 1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 65
1041355198_1041355207 -1 Left 1041355198 8:56993185-56993207 CCGTGGGCTCCCACCTGGACGCT 0: 1
1: 0
2: 1
3: 25
4: 190
Right 1041355207 8:56993207-56993229 TGGGGAAGGCGGTCTTGAGCAGG 0: 1
1: 0
2: 0
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041355198 Original CRISPR AGCGTCCAGGTGGGAGCCCA CGG (reversed) Exonic
900300594 1:1974893-1974915 AGCGGCCAGGTGAGAGCCGCTGG + Intronic
900545912 1:3229148-3229170 AGCAGCCAGGGAGGAGCCCAGGG + Intronic
900555942 1:3280565-3280587 AGGCTCCAGGTGGGAGTCGAGGG - Intronic
900870656 1:5300042-5300064 AATGGCCAGGTGGGAGCACAGGG + Intergenic
901231732 1:7645523-7645545 AGCCTCCAGGTGGGAGAGCTGGG - Intronic
901782237 1:11601799-11601821 ACCTTCCAGGGAGGAGCCCAAGG + Intergenic
902504849 1:16932654-16932676 GGCATGGAGGTGGGAGCCCATGG + Intronic
902640308 1:17762655-17762677 GGGCTGCAGGTGGGAGCCCAGGG + Intronic
903281030 1:22250174-22250196 AGAGTCCAGGTGGGAGCCTGTGG + Intergenic
903338610 1:22640937-22640959 ACCTGCCAGGTGGAAGCCCAGGG - Intergenic
904788544 1:33000369-33000391 AGAGGCCAGGTCGGAGGCCAGGG - Intergenic
907236966 1:53058915-53058937 AGCCTCTAGATAGGAGCCCAGGG - Intergenic
911052210 1:93681130-93681152 AGCGCTCTGGTGGAAGCCCAAGG - Intronic
911126105 1:94342493-94342515 TGAGCCCAGCTGGGAGCCCAAGG - Intergenic
915599474 1:156913428-156913450 AGCGGCCAGGTGGGGCCCAAGGG + Exonic
916585138 1:166143658-166143680 AGGGTCCTGATGGGAGGCCATGG + Intronic
916601111 1:166294380-166294402 AGTGTCCCTGTGGGAGCCAAGGG + Intergenic
919934684 1:202243734-202243756 AGGGCCCAAGTGGGAGCCCTGGG + Intronic
920375341 1:205505131-205505153 AGGGTTCAGACGGGAGCCCAGGG - Intronic
921546697 1:216482411-216482433 AGGGTCCAGGTGGGCTCCCCTGG - Intergenic
922422831 1:225471154-225471176 AGCTGGCAGGTGGGAGCCAAGGG - Intergenic
922990590 1:229907449-229907471 AGTGTCCAGAAGGGAGACCATGG - Intergenic
923043555 1:230337380-230337402 GTCATCCAGTTGGGAGCCCATGG + Intronic
923118579 1:230968571-230968593 AGGGGGCAGGTGGGAGGCCATGG + Intronic
923220457 1:231888276-231888298 AGCCTCCACCTGAGAGCCCAGGG - Intronic
923908182 1:238409320-238409342 AGCCTCCGGGTGGGAGCCACAGG - Intergenic
1064412713 10:15121341-15121363 TGCCCCCAGGTGGAAGCCCAAGG + Intronic
1065726996 10:28677004-28677026 AGGGTTCGGGTGGGAGCCCGGGG - Intergenic
1065888989 10:30104573-30104595 AGCGTCCAGGGAGGAGGGCAAGG + Intronic
1066317209 10:34259845-34259867 ATCGCCCAGGTTGGAGCGCAGGG + Intronic
1068015872 10:51515884-51515906 AGTGTCCAGGTGGGATGCTAAGG + Intronic
1070534989 10:77370325-77370347 AGCCTCCAGGTGGGGGCCTTGGG + Intronic
1070754812 10:78985465-78985487 GGCGTCCTAGGGGGAGCCCAGGG - Intergenic
1072632766 10:97158003-97158025 AGGGTCCATGTGGCATCCCAGGG + Intronic
1072983890 10:100122531-100122553 AGGGTGCAGGAGGGAGCCCAGGG - Intergenic
1073483399 10:103801156-103801178 AGAGTCCAGGTGGGAGCAGAGGG - Intronic
1075025337 10:118979795-118979817 AGCGACAAGGTGGGAGGCCCTGG - Intergenic
1075568232 10:123520125-123520147 TGAGTCCAGGTAGGAGCACAAGG - Intergenic
1076755822 10:132571113-132571135 AGGGCCCAGGGCGGAGCCCACGG - Intronic
1076824636 10:132960757-132960779 AGCGTCCAGATTGGACCCAAGGG + Intergenic
1076829245 10:132985903-132985925 AGGGTCCAGGTGGGGGTGCAGGG + Intergenic
1076829284 10:132985999-132986021 AGGGTCCAGGTGGGGGTGCAGGG + Intergenic
1077356629 11:2121834-2121856 AGGGGGCAGGTGGGACCCCAAGG - Intergenic
1077382301 11:2249875-2249897 CGCGGCGGGGTGGGAGCCCAGGG - Intergenic
1077454836 11:2672296-2672318 GGGCTCCAGGTGGGAGCTCAAGG + Intronic
1077550827 11:3199539-3199561 AGGGTGCAGGTTGGGGCCCAAGG + Intergenic
1080184463 11:29464354-29464376 AGAGAAGAGGTGGGAGCCCAGGG + Intergenic
1083685559 11:64373114-64373136 AGCCTCCAGAGGGGAGGCCATGG - Intergenic
1088645670 11:111914209-111914231 AGCATCCAAGTGCGAGCTCAGGG - Intronic
1088799233 11:113290259-113290281 AGCTTCCAGGTGCCACCCCAAGG + Intergenic
1089611484 11:119671910-119671932 AGTGTGCATGTGGGAGCCCGTGG - Intronic
1091587569 12:1824928-1824950 GGTGTCCAGGAGGAAGCCCAAGG + Intronic
1095986943 12:48005075-48005097 AACGTCCAGGTGGGAGTCTGGGG - Intergenic
1096021530 12:48329585-48329607 AGCGCCCAGGGGGCAGGCCAAGG + Exonic
1102456678 12:113075286-113075308 AGGGTCTGGGTGGGACCCCAGGG - Intronic
1102471106 12:113160354-113160376 AGACTCCAGGTGGGAGCCTTGGG + Intronic
1104041697 12:125134900-125134922 AGGGTCCTGGCGGGAGCCCCAGG + Intronic
1110596499 13:77326460-77326482 AGCCTCCAGGTGCGTCCCCAGGG - Exonic
1112241694 13:97688137-97688159 AGTTTCCAGGTTGTAGCCCAGGG + Intergenic
1114455226 14:22849552-22849574 AGCAGCCAGGAGGGAGCCAAGGG + Intergenic
1120948895 14:90022937-90022959 AACGTCCAGGTAGGAGCCTGGGG - Intronic
1121507296 14:94486720-94486742 AGTGTCCACGTGGGAGCTCTGGG - Intergenic
1122071859 14:99210119-99210141 AGCATCCAGGCCAGAGCCCAGGG + Intronic
1122556018 14:102580515-102580537 AGGGGGCAGGAGGGAGCCCAAGG + Intergenic
1122937397 14:104966522-104966544 TGCGTCCAGGTGGGAGCAGCAGG - Intronic
1122937985 14:104968632-104968654 GGCCTCCAGGTGGGAGGGCATGG + Intronic
1124414862 15:29466566-29466588 AGCCCCCAGGGGAGAGCCCAGGG + Intronic
1124484785 15:30104246-30104268 CGCCTCGAGGTGGGAGCCCGCGG + Intergenic
1124539859 15:30573254-30573276 CGCCTCGAGGTGGGAGCCCGCGG + Intergenic
1124758792 15:32434328-32434350 CGCCTCGAGGTGGGAGCCCGCGG - Intergenic
1125981540 15:44006421-44006443 AACATCCAGTTGGTAGCCCATGG + Intronic
1126430858 15:48582797-48582819 AGAGTCCCTGTGGGAGCACAAGG + Intronic
1129737410 15:77973967-77973989 AGCGGGAAGGAGGGAGCCCAGGG + Intergenic
1129848664 15:78779658-78779680 AGCGGGAAGGAGGGAGCCCAGGG - Intronic
1130113919 15:80989764-80989786 GGCTTCCAGGTGGGCGCGCAAGG - Exonic
1130352822 15:83107178-83107200 ATCGTCTATGGGGGAGCCCACGG - Intergenic
1130963716 15:88682003-88682025 CGCGTCCAGGACAGAGCCCAGGG - Intergenic
1132582094 16:689560-689582 AGCATCCAGGTGGCAGTGCATGG + Exonic
1133155664 16:3873765-3873787 GGTGGCCGGGTGGGAGCCCATGG + Intronic
1136186343 16:28590943-28590965 AGCCTCCAGGGGAGAGGCCATGG + Intronic
1139150924 16:64381224-64381246 GGAGTCCAGGAGGGAGGCCAGGG + Intergenic
1139529859 16:67537756-67537778 AGTTTCCAGGTGGGAGCCTCAGG + Intronic
1140701942 16:77589083-77589105 AGAGCCCAGGTAGGATCCCAGGG + Intergenic
1141507128 16:84485223-84485245 AGTTTCCAGGTGCCAGCCCAGGG - Intronic
1141674296 16:85509494-85509516 ACCCTCCAGGTGGGTGACCAAGG - Intergenic
1142994748 17:3753957-3753979 AGAGGCCAGGTGGGAGCACACGG - Intronic
1143501879 17:7343948-7343970 GGCGCCCAGGTGGGGCCCCAGGG + Exonic
1144781461 17:17810407-17810429 GGCGTGCAGCTGGGAGCCCTGGG + Exonic
1147657140 17:42097501-42097523 TGGGTCCAGCTGGGACCCCAGGG - Intergenic
1147887752 17:43696112-43696134 AGCACCCAGCTGGGAGCCCAGGG + Intergenic
1148693292 17:49545206-49545228 AGTGTCCCAGTGGGAGTCCAGGG + Intergenic
1149868424 17:60163004-60163026 AGCATCCGGGTGGGAGCCAGGGG + Intronic
1149996525 17:61408749-61408771 AGCGTCAAGGTGGCATCCGAAGG + Exonic
1150433558 17:65137602-65137624 AGGGTCCAGGTGAGGGGCCAGGG - Intronic
1150642304 17:66957833-66957855 AGCAGCCAGGTGAGAGCCCAGGG + Intergenic
1152121276 17:78420162-78420184 GGCGTCCAGGCAGCAGCCCACGG - Intronic
1152740341 17:82015923-82015945 AGCCTCCAGCCGGGGGCCCAGGG - Intronic
1203173717 17_GL000205v2_random:175521-175543 TGCCTCCCGGCGGGAGCCCACGG + Intergenic
1154290387 18:13101676-13101698 AAGGTCCAGGAGGGAGACCATGG - Intronic
1160216353 18:76935846-76935868 AGAGTGCTGGTGGGAGCCCGAGG - Intronic
1160277565 18:77451751-77451773 AGCTCCCAGGGGAGAGCCCAGGG + Intergenic
1160796088 19:946074-946096 GGCGTCCAGGTGGGAGCATGAGG + Intronic
1160890127 19:1373356-1373378 AGCGACCAGCTGGGAGACCCGGG - Intronic
1160940638 19:1619019-1619041 GGGGTCAGGGTGGGAGCCCAGGG - Intronic
1161475558 19:4482931-4482953 AGCGACCAGGAAGGAGCCCGGGG + Intronic
1165104372 19:33460400-33460422 AGTGTCCAGGTTGAAGCCCCTGG - Intronic
1165940578 19:39413069-39413091 TCCCTCCAGGTGGGAGCACAGGG - Exonic
1166889497 19:45981830-45981852 AGAGTCCAGGTGGGAGCTAATGG - Intergenic
1168694497 19:58396858-58396880 GGCGTCCAGGCGGGGGCCCAGGG - Exonic
1168694915 19:58398631-58398653 TGCTTCCAGGTGGGAGCCAGAGG + Intergenic
925889578 2:8422497-8422519 ACCGTCCATATGGGAGCCCCTGG + Intergenic
926198323 2:10776725-10776747 AGTGCCCAGGTGGGTGCCAAAGG - Intronic
931611592 2:64107177-64107199 AGCTTACAGGTGGGAGGCCTAGG - Intronic
932307730 2:70715796-70715818 GGAGTCAAGGTGGGATCCCATGG - Intronic
934980317 2:98833993-98834015 AGCTTGCAAGTGGGAACCCATGG + Intronic
937097868 2:119247531-119247553 ATGGTACAGGTGGGAGCCAATGG - Intronic
937645465 2:124261589-124261611 AGCGTCCAGGTGGGTGGCAGTGG + Intronic
947679177 2:232014109-232014131 AGCATCCAGGTGGAAGGCCAGGG + Intronic
948388682 2:237597300-237597322 AGAGTGCAGGTGCGTGCCCATGG - Intronic
1169264588 20:4160214-4160236 AGCTTCCCGGTGGCAGCCCCAGG + Intronic
1169266955 20:4172656-4172678 AGCGTCCAGTTCGGAGGCAAGGG - Intronic
1172081554 20:32345104-32345126 AGCCTGCAGGAGGGAGCCCAGGG + Intergenic
1172139665 20:32713496-32713518 AGTGTACAAATGGGAGCCCAAGG + Intronic
1173192328 20:40886176-40886198 ATCGTCCAGGTGCCTGCCCATGG + Intergenic
1174035503 20:47666062-47666084 AGTGTCCAGGTGGAAGTCGAGGG - Intronic
1174035543 20:47666234-47666256 AGTGTCCAGGTGGAAGTCGAGGG - Intronic
1174181910 20:48680281-48680303 ATAGTCCAGGTGGGAGGCGAAGG - Intronic
1174349230 20:49955248-49955270 GGCCTTAAGGTGGGAGCCCATGG + Intergenic
1174776642 20:53349079-53349101 AGTGTCCAGGTGTGCCCCCAAGG + Intronic
1175874930 20:62224848-62224870 AGACTCCAGGTGGGAGGCAATGG + Intergenic
1176253950 20:64140827-64140849 AGGGAGCAGGTGGGAGGCCAAGG + Intergenic
1180146622 21:45923634-45923656 TGCATCCAGTTGGAAGCCCAGGG + Intronic
1183214507 22:36470495-36470517 AGTGTGCAGGTGGGAGCCGGTGG - Intronic
1185046172 22:48529683-48529705 GGTGTCCAGGTGGGATTCCAGGG + Intronic
1185340359 22:50288212-50288234 AGGATCCCGATGGGAGCCCAGGG + Intronic
950222241 3:11205309-11205331 AGCCTACAGGTGGGACTCCAGGG - Intronic
950528501 3:13539001-13539023 AGAGTCCAGGTGGGAGATGATGG - Intergenic
950572062 3:13807381-13807403 AGCTTCCAGGTGGTGGCCCGGGG - Intergenic
952931917 3:38367104-38367126 AGGGTCCAGGTGGGAGCACTGGG + Intronic
953545287 3:43859896-43859918 ACTGTCCAGGCGGCAGCCCAGGG + Intergenic
956369038 3:68538079-68538101 AGCCTCCAGGTGGGGGCCACAGG + Intronic
957523742 3:81353570-81353592 AGCAGCCAGCTGGGAGCACAGGG - Intergenic
960594710 3:119397650-119397672 AGCCTCAAGCTGGGAGACCAAGG + Intronic
968815664 4:2820441-2820463 GGCTTCCAGGTGGGACCCCAGGG - Intronic
969131382 4:4993372-4993394 CTAGTCCAGGTGAGAGCCCATGG - Intergenic
969333713 4:6494655-6494677 GCCGTCCAGGTGGGAGCCCCGGG + Intronic
969610204 4:8223420-8223442 AGTGTCATGGTGGGACCCCAGGG + Intronic
970134919 4:12912092-12912114 AGTGTCCAGAAGGGAGCCCAGGG - Intergenic
971655166 4:29334944-29334966 ATTGTCAAGGTAGGAGCCCAGGG + Intergenic
981840504 4:149106246-149106268 AGGGTCCAGGTTGAAGCCCCTGG - Intergenic
985673926 5:1220628-1220650 AGTGTCCAGGTGGGTACCCATGG - Intronic
985727460 5:1523696-1523718 AAGGCCCAGGTGGGTGCCCAGGG - Exonic
989784535 5:45311996-45312018 AGAGTCCACGTTGGAACCCAAGG + Intronic
997357946 5:133276385-133276407 AGCAGCCAGGAGGGAGGCCAGGG - Intronic
1000681847 5:164194884-164194906 AGTCTCCAGGAGGGAGGCCAGGG - Intergenic
1002373775 5:178774431-178774453 AGGGTCCTGGTGGGAGCCCCAGG - Intergenic
1002437347 5:179239731-179239753 AGCGTCCAGGACAGAGCCCTGGG + Intronic
1004297168 6:14423348-14423370 AGCGGCAAGGTGGGAACTCAGGG + Intergenic
1004551660 6:16653869-16653891 AGGGTCCAGGTCTGAGCCTATGG - Intronic
1005390073 6:25324049-25324071 ATCCTCCATCTGGGAGCCCATGG + Intronic
1005506320 6:26471857-26471879 AGAGTCCAGGTGAGACCTCAAGG + Intronic
1007757432 6:44109331-44109353 ACTGTGCAGGTGGGAGCCCAAGG - Intergenic
1009817670 6:68756644-68756666 AGAGACCAGATGGGAGCTCAGGG + Intronic
1012548564 6:100448036-100448058 AGAGGACAGGTGGGAGCCCAGGG - Intronic
1017233434 6:152096233-152096255 AGGGTCCTGGTGTAAGCCCAAGG - Intronic
1018933331 6:168256747-168256769 AGCTTCCAGGTTAGAACCCAGGG + Intergenic
1018981482 6:168605023-168605045 AGAGTCCAGGTGGGAGCCGAGGG + Intronic
1019205707 6:170359954-170359976 AGGGCCCAGGAGGGAGGCCAGGG - Intronic
1019490647 7:1311692-1311714 AGCATGCAGGTGGGCGCCCAAGG - Intergenic
1023157480 7:37265599-37265621 TACCTCCAGGTGGCAGCCCAGGG + Intronic
1029521725 7:101067062-101067084 TGCCTCCTGGTGGGAGCCAAGGG + Intergenic
1030293101 7:107891442-107891464 AGCGGCCACCTCGGAGCCCAGGG - Intronic
1032080307 7:128855306-128855328 AGCCTCCAGGTTTGTGCCCAGGG + Exonic
1032262195 7:130346816-130346838 AGAGTCCAGGAGGAAGCCCCCGG + Intronic
1035046990 7:155974194-155974216 GCCCTCCAGGTGGGATCCCATGG - Intergenic
1035629349 8:1096559-1096581 AGAGTCAAGCTGGGAGCCTAGGG + Intergenic
1035629461 8:1097009-1097031 AGAGTCAAGCTGGGAGCCCGGGG + Intergenic
1035629484 8:1097099-1097121 AGAGTCAAGCTGGGAGCCCAGGG + Intergenic
1035629505 8:1097189-1097211 AGAGTCGAGCTGGGAGCCTAGGG + Intergenic
1035629527 8:1097279-1097301 AGAGTCCAGCTGGGAGCCCGGGG + Intergenic
1035629576 8:1097459-1097481 AGAGTCAAGCTGGGAGCCTAGGG + Intergenic
1035629622 8:1097639-1097661 AGAGTCGAGCTGGGAGCCCGGGG + Intergenic
1035629642 8:1097729-1097751 AGAGTCGAGCTGGGAGCCTAGGG + Intergenic
1035629686 8:1097909-1097931 AGAGTCGAGCTGGGAGCCTAGGG + Intergenic
1036411265 8:8503831-8503853 AGAGAGCAGATGGGAGCCCAAGG + Intergenic
1036517116 8:9454631-9454653 ATTGTCTAAGTGGGAGCCCAGGG + Intergenic
1038613238 8:29072074-29072096 AGCGTCCAGGCCGGGGCCCAGGG + Exonic
1041355198 8:56993185-56993207 AGCGTCCAGGTGGGAGCCCACGG - Exonic
1041623023 8:59995435-59995457 AGAATCCAGGTGGGAGACCATGG - Intergenic
1042540989 8:69906987-69907009 AGAGTCCATTTGGGAGGCCAAGG + Intergenic
1049544269 8:143222070-143222092 AGCGTCCATGTGGGTTCCCCAGG + Intergenic
1049562073 8:143316925-143316947 GGCATCCAGGTGAGAGCCCCAGG - Intronic
1049767153 8:144360186-144360208 GGCCTCCAGGTGGGAGCCCCAGG + Exonic
1049782065 8:144433682-144433704 GGCGTGCAGGAGGGAGGCCAGGG + Exonic
1049799370 8:144510663-144510685 GGTGTCCAGGTGGAAGACCAAGG - Exonic
1050550245 9:6742889-6742911 AGCCTCCTGGTGAGACCCCATGG - Intronic
1050598348 9:7226515-7226537 AGCGTGGAGTTGAGAGCCCAGGG + Intergenic
1050622395 9:7467942-7467964 AACGTCCAGAGTGGAGCCCATGG - Intergenic
1053202947 9:36165129-36165151 AGCTTGCAGGTGGGAGGGCAGGG + Intergenic
1057050014 9:91916456-91916478 AGGGGCAGGGTGGGAGCCCAGGG - Intronic
1057496226 9:95563632-95563654 TGCGTCCACGAGGGAGCCCCAGG - Intergenic
1059522498 9:114956803-114956825 AGGCCTCAGGTGGGAGCCCAAGG + Intergenic
1060394284 9:123304600-123304622 AGGGTGCTGGTGGGAGTCCATGG - Intergenic
1060594506 9:124840212-124840234 AAGTTCCAGGTGTGAGCCCATGG + Intergenic
1061417213 9:130453593-130453615 ATCCCCCAGGTGGTAGCCCAGGG - Intronic
1061776861 9:132971409-132971431 AGTATTCAGGTGGGAGGCCATGG - Intronic
1061930946 9:133832909-133832931 GGCCTCCAGGTGGGCGCCCCAGG + Intronic
1062018488 9:134304415-134304437 GGGGTCCAGCTGGGAGACCAGGG - Intergenic
1062213713 9:135378018-135378040 AGCTTCCAGGAGGGGGCCCTTGG - Intergenic
1062279787 9:135746816-135746838 AGTGGCCAGGCAGGAGCCCAAGG + Intronic
1185842274 X:3402989-3403011 AGCGTCCAGGTCAGAGGCCAAGG - Intergenic
1185913664 X:4010354-4010376 AGCTTTCAGGTGGCAGGCCATGG - Intergenic
1186029052 X:5346990-5347012 AATGTGCAGGTGGAAGCCCATGG - Intergenic
1187170013 X:16841666-16841688 AGCCTCCAGGTGCGCTCCCAGGG - Exonic
1190439910 X:50467167-50467189 TGCCACCAGGTGGGAGACCATGG + Intronic
1192186436 X:68949973-68949995 AGAGTGCTGGTGGGAGACCAAGG - Intergenic
1196396511 X:115268559-115268581 AGAGTCCAGGTGAGAGACGATGG - Intergenic