ID: 1041355203

View in Genome Browser
Species Human (GRCh38)
Location 8:56993194-56993216
Sequence GCCTTCCCCAGCGTCCAGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041355203_1041355209 9 Left 1041355203 8:56993194-56993216 CCCACCTGGACGCTGGGGAAGGC 0: 1
1: 0
2: 0
3: 25
4: 219
Right 1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 65
1041355203_1041355208 5 Left 1041355203 8:56993194-56993216 CCCACCTGGACGCTGGGGAAGGC 0: 1
1: 0
2: 0
3: 25
4: 219
Right 1041355208 8:56993222-56993244 TGAGCAGGTAGAACATCTTGCGG 0: 1
1: 0
2: 0
3: 12
4: 136
1041355203_1041355207 -10 Left 1041355203 8:56993194-56993216 CCCACCTGGACGCTGGGGAAGGC 0: 1
1: 0
2: 0
3: 25
4: 219
Right 1041355207 8:56993207-56993229 TGGGGAAGGCGGTCTTGAGCAGG 0: 1
1: 0
2: 0
3: 12
4: 159
1041355203_1041355210 27 Left 1041355203 8:56993194-56993216 CCCACCTGGACGCTGGGGAAGGC 0: 1
1: 0
2: 0
3: 25
4: 219
Right 1041355210 8:56993244-56993266 GTTGGACAGCACGTCGCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041355203 Original CRISPR GCCTTCCCCAGCGTCCAGGT GGG (reversed) Exonic
900593961 1:3472084-3472106 CCCTTACCCAGCGTGGAGGTGGG - Intronic
901060330 1:6468889-6468911 GTCTCCCCCAGAGTCCGGGTGGG - Intronic
901703081 1:11055806-11055828 ACCTACCCCAGCGGCCAGATCGG - Exonic
901764978 1:11494205-11494227 GCCTTCCCTAGCGTCCTTGCAGG + Intronic
902436118 1:16398989-16399011 CCCTTCCCCAGCGGCCTGGAGGG + Intronic
903186467 1:21632086-21632108 GCCTGGCCCAGACTCCAGGTTGG - Intronic
903926464 1:26834076-26834098 GGCCTCCCCAGCTGCCAGGTGGG - Intronic
904403986 1:30274485-30274507 GCCTTCCCCAGCCTGAAGGTGGG + Intergenic
905346708 1:37316116-37316138 TCCTTGGCCAGCCTCCAGGTAGG + Intergenic
906035054 1:42745480-42745502 TCCTGCCTCAGCGTCCAGCTGGG + Intergenic
906737690 1:48147761-48147783 GCCTTCTCCAGTGTCCAGGATGG - Intergenic
906913512 1:49982581-49982603 GCCCTCCCCAGCTTGAAGGTGGG - Intronic
907185576 1:52606792-52606814 GCCTTCCCCTGCAACCAGTTTGG + Exonic
911485777 1:98503023-98503045 GCTTTCACCAGTGTCCTGGTGGG - Intergenic
915316186 1:155030332-155030354 CCCTGCCCCAGCATCCAGGGAGG - Intronic
919162847 1:193853700-193853722 GCCTGCAGCAGTGTCCAGGTAGG - Intergenic
919822630 1:201482574-201482596 GCCTTTCTCAGAGTCCAGGAGGG + Intergenic
921971545 1:221154608-221154630 TCCTTCCCCTGCTTCCAGCTGGG + Intergenic
922780646 1:228249954-228249976 GCCTTCCCCAGAGCCCAAGGCGG + Exonic
922781520 1:228256640-228256662 GCCTTCCCCAGAGCCCAAGGTGG + Exonic
922781915 1:228259490-228259512 GCCTTCCCCAGAGCCCAAGGCGG + Exonic
922782486 1:228264105-228264127 GCCTTCCCCAGAGCCCAAGGCGG + Exonic
922911825 1:229224951-229224973 TTCTTCCCCAGCATCCAAGTTGG - Intergenic
1062829793 10:597971-597993 GTCAGCCCCAGAGTCCAGGTAGG - Intronic
1064263867 10:13808811-13808833 ACCTGCCCCAGAGTCTAGGTGGG - Intronic
1064582763 10:16810774-16810796 GCCTGCCCCAGCCTCCCGGGTGG - Intronic
1071052934 10:81473409-81473431 GCCTTCCCCGGCTTGAAGGTGGG - Intergenic
1073566367 10:104538906-104538928 GCCTTTCCCAGCCTCCAAGAAGG + Intergenic
1077261729 11:1625549-1625571 CCCTTCCACAACCTCCAGGTGGG + Intergenic
1079027635 11:16961431-16961453 GCCTTCCTCAGCTTCCAGCCAGG + Intronic
1081163971 11:39785998-39786020 GCCTTCCCCAGCTCGAAGGTAGG + Intergenic
1081658991 11:44876327-44876349 GCCTTCTACAGTGTCCAGGCTGG - Intronic
1083639253 11:64136524-64136546 GCATCCCCCAGCCTCCAGGCAGG - Intronic
1084227313 11:67725319-67725341 ATCTTTCCCAGTGTCCAGGTGGG + Intergenic
1084238908 11:67805635-67805657 GGCTTCGGAAGCGTCCAGGTTGG + Intergenic
1084807880 11:71591529-71591551 ATCTTTCCCAGTGTCCAGGTGGG - Intronic
1084833520 11:71787204-71787226 GGCTTCGGAAGCGTCCAGGTTGG - Intergenic
1085270924 11:75269348-75269370 GCCCTTCCCAACTTCCAGGTCGG + Intronic
1085297668 11:75440047-75440069 CCCTTCCCCAGTGGCCATGTGGG - Intronic
1087107317 11:94423516-94423538 GCCTGCCCCAGCATTCAGGTGGG - Intronic
1090305555 11:125688103-125688125 GGCTTCACCAGCCTCCAGGAAGG - Intergenic
1091010975 11:132000130-132000152 GCCTTGCCTGGCTTCCAGGTGGG - Intronic
1092409599 12:8243268-8243290 GGCTTCGGAAGCGTCCAGGTTGG + Intergenic
1096743805 12:53712770-53712792 CCCTTCCCCAACCACCAGGTAGG - Intronic
1096782744 12:54000501-54000523 TCCTTCCCCAGCTTCCCGGCCGG + Exonic
1097446508 12:59678726-59678748 GCCTTCCCCAGCTTGAAGGTGGG + Intronic
1097500242 12:60392467-60392489 GCCTTCCCCATCTTGTAGGTGGG - Intergenic
1097987900 12:65803648-65803670 GCCTTCACCTGCATCCATGTTGG - Intergenic
1098290865 12:68955941-68955963 GCCGTCCCCAGCTTGGAGGTGGG + Intronic
1098951585 12:76645344-76645366 GCCCTCCCCAGCTTGAAGGTGGG - Intergenic
1099693469 12:85991424-85991446 GCCTTCACCAGCCTGAAGGTGGG + Intronic
1112430534 13:99346701-99346723 GCCTTCCCCAGCTTCCTGGGGGG + Intronic
1112705809 13:102068444-102068466 GTCTTCCTCAGCTTGCAGGTAGG + Intronic
1113314025 13:109159762-109159784 TCCTTCTCCAGCGTCCAGCAGGG - Intronic
1113738875 13:112697210-112697232 GCCTTCCCCAGGGCCACGGTGGG + Intronic
1113970671 13:114185928-114185950 GCCCTCCCCAGCTTGAAGGTGGG - Intergenic
1114516245 14:23301953-23301975 GCCGACCCCGGCGTCCAGGCCGG + Intronic
1116716303 14:48431078-48431100 CCCTTCAGCAGCATCCAGGTGGG + Intergenic
1118200109 14:63663677-63663699 GCCTTCCCCAGCTTGAAGGCGGG + Intergenic
1118816150 14:69315541-69315563 GCCTTCCCCAGCAGGCAGGGCGG - Intronic
1120798507 14:88663026-88663048 ACCATCCCCAGCGTGGAGGTAGG - Exonic
1121491262 14:94363175-94363197 GACTTCCCCAACCTCCGGGTTGG + Intergenic
1121628784 14:95407461-95407483 GCCTTCCCCGCCATCCAGGGAGG - Intronic
1122328264 14:100895709-100895731 GGCTACCCCAGCCTGCAGGTTGG + Intergenic
1122441772 14:101736922-101736944 TGTGTCCCCAGCGTCCAGGTTGG - Intergenic
1122918336 14:104869000-104869022 GCCTTCACCAGGGTGCAGCTGGG - Intronic
1122977687 14:105177656-105177678 GGCTTCCCCAGTGGCCAGGCTGG + Intronic
1123051715 14:105547250-105547272 GGCTTCCTCAGCCTCCAGGCAGG + Intergenic
1123077129 14:105672953-105672975 GGCTTCCTCAGCCTCCAGGCAGG + Intergenic
1124820837 15:33044309-33044331 ACCTTCCCCAGCTTGAAGGTGGG - Intronic
1125731012 15:41892889-41892911 GCCTTCCTCAGGGCCAAGGTGGG - Exonic
1125767011 15:42142650-42142672 CCCTTCCCTAGCATCGAGGTGGG - Exonic
1128430804 15:67591483-67591505 TCCTGCCCCAGCCTCCAGCTGGG + Intronic
1128699518 15:69794122-69794144 GCCTTTCCCAGCCTCCAGCAGGG + Intergenic
1129318789 15:74762481-74762503 GCCCTCCCCAGCTTCTGGGTGGG - Intergenic
1130375403 15:83324541-83324563 GACTTTCCCAGCGTCTAGGTAGG - Intergenic
1131867082 15:96722523-96722545 GCCTTTCCCAGGGGCCAGGAGGG + Intergenic
1132804826 16:1770589-1770611 GCCTCCTCCAGGGCCCAGGTGGG - Exonic
1133350574 16:5098049-5098071 GGCTTCAGAAGCGTCCAGGTTGG + Intergenic
1133742733 16:8663564-8663586 ACCTCCCCCAGCCTCCAGGTGGG - Intergenic
1140076066 16:71699812-71699834 GCTTGCAGCAGCGTCCAGGTGGG - Intronic
1140750347 16:78017918-78017940 GCCTTCCCCAAAGACAAGGTGGG + Intergenic
1142357021 16:89606057-89606079 CCCTTCCCCTGCCTCCAGGGAGG + Intergenic
1144202372 17:12953106-12953128 GCCTCCCCCAGCTCCCATGTAGG - Intronic
1147189657 17:38731047-38731069 GCCTTCCCTAGCACGCAGGTGGG + Intronic
1148550049 17:48544736-48544758 ACCTTCCCCAGCCTCCAGCCCGG - Exonic
1149362510 17:55910579-55910601 GCCCTCCCCAGCTTGAAGGTAGG + Intergenic
1151550034 17:74817290-74817312 GCCTTCCCAAGCGTTATGGTCGG + Intronic
1151882644 17:76904405-76904427 CCCCTCCCCAAAGTCCAGGTGGG + Exonic
1151944353 17:77311381-77311403 TCCATCCACAGCGGCCAGGTGGG - Intronic
1152551502 17:81032634-81032656 GCCTTCACCAGCGTCCTGTGAGG - Intergenic
1153642780 18:7170443-7170465 GGCTTGGCCAGCCTCCAGGTGGG - Intergenic
1155998494 18:32358226-32358248 GCCTTCCCCATCTCACAGGTGGG + Intronic
1156457432 18:37302639-37302661 GCCTCCCCAGGCTTCCAGGTGGG + Intronic
1160689660 19:455740-455762 GCCTTTCCCAGCGTCCTGAGGGG + Intronic
1160973579 19:1781124-1781146 TCCCTCCCCAGCCTCGAGGTGGG - Intergenic
1162451816 19:10759593-10759615 GCATTCCCCAGGGCCCAGCTGGG + Intronic
1162910153 19:13843796-13843818 GCCTGGCCCAGTGCCCAGGTGGG + Intergenic
1163779821 19:19240309-19240331 CCCTTCCCCAGCCTGGAGGTGGG - Intronic
1163779872 19:19240474-19240496 ACCTTCCCCAGCCTGGAGGTGGG - Intronic
1164632604 19:29771511-29771533 GCCTTCCATGGGGTCCAGGTAGG - Intergenic
1165242712 19:34481205-34481227 GCCTTCCCCAGCAGTCAGATGGG + Intergenic
1167419590 19:49395133-49395155 GCCTGTCACAGCCTCCAGGTAGG - Exonic
1168133822 19:54337545-54337567 GCCTCCCCCAGCGCCCTGGCCGG - Exonic
926297277 2:11577911-11577933 GCCATCCCCAGCGGCCAGTGAGG - Intronic
926344282 2:11931043-11931065 TCCTTCCCCAGTGCCCAGGAGGG - Intergenic
927710539 2:25323020-25323042 GCCTTCCCCTCCTTCCCGGTGGG + Intronic
928293623 2:30061682-30061704 GATTTCCCCAGGGCCCAGGTGGG - Intergenic
928491292 2:31785982-31786004 GCCTTGCCCAGCCTCCAGGAAGG + Intergenic
929014554 2:37481615-37481637 GCCCTCCCCAGCTTGAAGGTGGG - Intergenic
930800550 2:55438473-55438495 GCCTTCCCCTGTGTAAAGGTGGG - Intergenic
932716403 2:74102938-74102960 GCTTTCCCCAGAAACCAGGTTGG + Exonic
933093278 2:78146689-78146711 GCCCTCCCTGGCGTGCAGGTGGG - Intergenic
936244134 2:110811808-110811830 GACTTCCCCAGCAACCAAGTAGG - Intronic
937667087 2:124499998-124500020 GTCTTCTCCAGCGTTCAGGCTGG - Intronic
937919945 2:127121968-127121990 CCCTGCCCCAGGGTCCAGGTGGG + Intergenic
937930571 2:127201776-127201798 GCGATCCCCAGTGGCCAGGTGGG - Intronic
941717220 2:168776909-168776931 GCCTTAGCCAAGGTCCAGGTGGG + Intergenic
941795424 2:169593760-169593782 TCCTGCCTCAGCCTCCAGGTGGG + Intronic
942328749 2:174798988-174799010 CCCTTCTCCAGCCACCAGGTTGG + Intergenic
945658182 2:212651321-212651343 GCCCTCCCAAGCAGCCAGGTGGG - Intergenic
945766510 2:213986208-213986230 GAATTGCCCAGCGTCCAGGAAGG + Intronic
945770405 2:214035306-214035328 GCCCTCCCCAGCTCACAGGTGGG + Intronic
947918649 2:233850914-233850936 GCCTCCCCCAGCCTCCAGGGCGG + Intronic
948138525 2:235655847-235655869 TTCTTCCCCAGCATCCAGGATGG - Intronic
948612879 2:239180847-239180869 GGCTGCCCCAGCCTCCAGGACGG + Intronic
948981520 2:241497142-241497164 TCCCTCCCCAGGCTCCAGGTGGG + Intronic
1169091127 20:2862043-2862065 CCCTTCCCCAGCGGCCAGCGAGG + Exonic
1170569609 20:17625409-17625431 GCCCTCCCCCGAGTCCAGGGCGG + Intronic
1171382565 20:24744658-24744680 GTCTTGCCCAGGGTACAGGTTGG + Intergenic
1171849807 20:30300382-30300404 GTCTGGCCCAGCGTCCAGGGCGG - Intergenic
1172427243 20:34863592-34863614 GCCCTGCCCACCCTCCAGGTGGG + Intronic
1173039681 20:39450696-39450718 GCCCTCCAGAGCTTCCAGGTTGG + Intergenic
1174546262 20:51327697-51327719 GCGTTCCCCAGCGGCCAGCTCGG + Intergenic
1175065095 20:56277472-56277494 GCCTTCTCCAGCCTGAAGGTGGG - Intergenic
1175916445 20:62428213-62428235 GGCTTCTCCAGTCTCCAGGTAGG + Intergenic
1177029665 21:15967048-15967070 CCCATCCCCAACCTCCAGGTTGG + Intergenic
1178906688 21:36642595-36642617 GCCTTCCCCTGCTTCCAGCCAGG + Intergenic
1179146165 21:38769716-38769738 GCCTTCCCCAGGGCCCTGGGAGG - Intergenic
1179641731 21:42752162-42752184 GCCTTCCACAGCCTCCATGTAGG + Intronic
1179925676 21:44532954-44532976 TCCTTCCCCAACCTCCAGGCTGG - Intronic
1180178953 21:46109459-46109481 GCCTGCCCCAGCCTGAAGGTGGG + Intronic
1180183884 21:46130069-46130091 GCCTTCACCTGCCACCAGGTGGG - Intronic
1180880388 22:19199278-19199300 CCCTTCCAAAGGGTCCAGGTGGG + Intronic
1183316900 22:37141873-37141895 GCCCTCCCCAGCCTGAAGGTGGG - Intronic
1184151815 22:42643833-42643855 ACCCTCCCCATCCTCCAGGTAGG - Intronic
1184768904 22:46586731-46586753 GCTTTCCCCAGCAGACAGGTAGG - Intronic
1184802107 22:46767745-46767767 CTCTTCCCCAGCCTCCTGGTTGG - Intronic
1184949950 22:47834165-47834187 GCCTTTCCCATCCCCCAGGTTGG + Intergenic
949299865 3:2571129-2571151 GCATTCCCCTGCCTTCAGGTTGG + Intronic
950416904 3:12873975-12873997 GCCTTCCCCAGAGTCACAGTAGG - Intergenic
950702068 3:14757657-14757679 GGCTCCCCCTGCATCCAGGTTGG + Exonic
952408532 3:33026525-33026547 GCCCTCCCCAGCTTGAAGGTGGG - Intronic
952965361 3:38617736-38617758 GTCTTGCCCAGGCTCCAGGTTGG + Intronic
953802029 3:46031641-46031663 GCCTTCCCCAGCTTGAAGGTGGG - Intergenic
954028886 3:47803702-47803724 GCCTCCCCCAGTGACAAGGTCGG - Intronic
957054843 3:75435396-75435418 GGCTTCAGAAGCGTCCAGGTTGG + Intergenic
958195302 3:90235670-90235692 GCCTTCCCCAGCCTGAAGGTGGG - Intergenic
958418711 3:93907077-93907099 GCCTTCCCCAGCCTGAAGGTGGG - Intronic
960254912 3:115501651-115501673 GCCATCCCCTGCCTCCAGTTAGG + Intergenic
961299996 3:125916279-125916301 GGCTTCGGAAGCGTCCAGGTTGG - Intergenic
961457121 3:127029785-127029807 GCCATCCCCAGCTTTCAGATGGG + Intronic
961683657 3:128615567-128615589 GCCTTCCCTATTCTCCAGGTGGG - Intergenic
961888508 3:130111795-130111817 GGCTTCGGAAGCGTCCAGGTTGG + Intronic
964414370 3:156431967-156431989 CCCTTCCCCAGTGTCAGGGTGGG - Intronic
965924311 3:173958685-173958707 GCCTTCCCCAGCTTGAAGGTAGG + Intronic
967895894 3:194396313-194396335 GCCTTCCCCAGCTCCCACGCGGG - Exonic
968548522 4:1210693-1210715 GCCTTTCCCTGCATGCAGGTGGG - Intergenic
968625126 4:1623537-1623559 GCCTTCCCCGGCGGCCTGGCCGG + Intronic
968813598 4:2810797-2810819 GCCTGCCTCATCGTCCAGGCTGG + Intronic
968954553 4:3711615-3711637 GGTTTCCCCAGAGTCCAGGCAGG + Intergenic
968959481 4:3735649-3735671 TCCCTCCACAGCGTCCAGGCTGG + Intergenic
968997653 4:3955703-3955725 GGCTTCGGAAGCGTCCAGGTTGG + Intergenic
969351354 4:6599816-6599838 GCCTTCCAGAGCCTGCAGGTTGG - Intronic
974260299 4:59517979-59518001 GCCCTCCCCAGCTTAAAGGTGGG + Intergenic
974683508 4:65195074-65195096 GCCCTCCCCAGCTTGAAGGTGGG + Intergenic
974761847 4:66286106-66286128 GCCCTCCCTAGCTTCAAGGTTGG + Intergenic
975040872 4:69743511-69743533 GCCCTCCCCAGCTTGAAGGTGGG + Intronic
975321303 4:73012077-73012099 GCCCTCCCCAGCTTGAAGGTGGG - Intergenic
978370025 4:108020568-108020590 GGCTTCCCCAGCATCCTGTTTGG + Intronic
982158062 4:152540583-152540605 GCCTTCCCCAGCCTAAAGGTGGG + Intergenic
982357739 4:154489259-154489281 CCCTTCCCAAGCCTTCAGGTTGG + Intronic
984325186 4:178242001-178242023 GCCTTCCCCAGCTTGAAGCTGGG - Intergenic
985964623 5:3330425-3330447 CCCTTCCCCAGGGTCCAGTCTGG + Intergenic
986321742 5:6637184-6637206 GCCTTCCCCAGCCTCCTGGCAGG + Intronic
986739427 5:10693041-10693063 TCCTTCCCAAGCATCCTGGTAGG + Intronic
990619183 5:57541615-57541637 GGCTTTCCCAGGGTCCAGCTAGG - Intergenic
992813027 5:80408237-80408259 GCCAGACCCAGCGCCCAGGTCGG - Intronic
993703358 5:91143726-91143748 GCCTTCCCCAGCTTGAAGGTGGG + Intronic
994040665 5:95256299-95256321 GCCATGCCCCGCTTCCAGGTAGG - Intronic
994379699 5:99056807-99056829 GGCTCTTCCAGCGTCCAGGTCGG + Intergenic
995194570 5:109349503-109349525 GCCTCCCCCAGCATCCATGTTGG + Intronic
998060866 5:139117847-139117869 GCCTTCCCTGCAGTCCAGGTAGG - Intronic
1000209240 5:159095848-159095870 CCCTTCCCCAGTGTCCAGAGAGG + Intronic
1001370622 5:171196898-171196920 TCCTACCCCAGCTTCCAAGTAGG + Intronic
1002981579 6:2143434-2143456 TCCTGCCCCAGCATCCAGGTGGG + Intronic
1004487570 6:16081817-16081839 GCCTACCCCAGCACCCAGGATGG - Intergenic
1006084695 6:31587573-31587595 GCGTACCCCAGCCTCCTGGTTGG - Intronic
1008020026 6:46565864-46565886 ACCTACCCCAGCCTCCAGCTTGG + Intronic
1009846909 6:69146027-69146049 GCCTTCCCCAGCTTGAAAGTAGG + Intronic
1012752764 6:103184228-103184250 GCCCTCCCCAGCTTGAAGGTGGG - Intergenic
1015434721 6:133172566-133172588 GCCTTCCCCAACTTGAAGGTGGG - Intergenic
1017769812 6:157636413-157636435 GTCCTCCCCAGAGTTCAGGTTGG + Intronic
1019269510 7:139206-139228 GCCCTCCCCAGGGCCCAGGCAGG - Intergenic
1019373576 7:676764-676786 GCCCTCCCCGGCCTCCAGGGAGG - Intronic
1019917261 7:4141654-4141676 GCCTTCCCCAGCATCCCCGATGG - Intronic
1023499642 7:40833753-40833775 GCCTTCACCACTGTCCAGCTGGG - Intronic
1023965754 7:44962399-44962421 GCCCTCGCCAGTGGCCAGGTAGG + Intergenic
1024058957 7:45684017-45684039 GTCTTGCCCAGAGGCCAGGTTGG + Intronic
1028670203 7:93393547-93393569 GCCTTCCTCAGCGGCCTGGATGG - Intergenic
1030463916 7:109875789-109875811 ACCTTCCCCAGGATCTAGGTTGG - Intergenic
1030570274 7:111213468-111213490 GCCCTCCCCAGCTTGAAGGTGGG - Intronic
1031086712 7:117309318-117309340 GTCTGTCCCAGCGCCCAGGTAGG + Intronic
1033315572 7:140294526-140294548 GCCCTACCCACCGTCAAGGTAGG - Intronic
1034210419 7:149358199-149358221 GCCTTCCCCAGCTTGAAGGTGGG + Intergenic
1035457906 7:159021244-159021266 GCCTTCCCCAGCCTGAAGGTGGG + Intergenic
1036379593 8:8228258-8228280 GTCTTCGGAAGCGTCCAGGTTGG - Intergenic
1036849967 8:12194357-12194379 GGCTTCGGAAGCGTCCAGGTTGG + Intergenic
1036871330 8:12436630-12436652 GGCTTCGGAAGCGTCCAGGTTGG + Intergenic
1036915461 8:12799757-12799779 GTCTTCCCCAGCTTGAAGGTGGG + Intergenic
1041299975 8:56401260-56401282 GCCTTCCCCTTCTTCCTGGTTGG - Intergenic
1041355203 8:56993194-56993216 GCCTTCCCCAGCGTCCAGGTGGG - Exonic
1044849872 8:96417749-96417771 GCCTCCTCCAGAGTCCAGGAGGG - Intergenic
1045057913 8:98385123-98385145 ACCTTCCCCAGTGCCCAGCTTGG - Intergenic
1046547164 8:115667709-115667731 GCCTTCTCCAGAGCCCAGCTGGG + Intronic
1048923833 8:139253250-139253272 GCCTCCCCCAGCTTCCATCTCGG - Intergenic
1049220352 8:141426102-141426124 CCCCTCCCCAGCCTCCAGGCAGG - Intronic
1051029619 9:12658567-12658589 GCCCTCCCCAGCTTAAAGGTGGG + Intergenic
1053787577 9:41663675-41663697 GTCTGGCCCAGCGTCCAGGGCGG - Intergenic
1054157546 9:61651092-61651114 GTCTGGCCCAGCGTCCAGGGCGG + Intergenic
1054175855 9:61875012-61875034 GTCTGGCCCAGCGTCCAGGGCGG - Intergenic
1054477320 9:65582097-65582119 GTCTGGCCCAGCGTCCAGGGCGG + Intergenic
1054661684 9:67705796-67705818 GTCTGGCCCAGCGTCCAGGGCGG + Intergenic
1054765533 9:69039520-69039542 GTCCTTCCCAGCCTCCAGGTAGG - Intronic
1056956415 9:91085159-91085181 CCCATCCCCAGCCTCCAGGGAGG + Intergenic
1060109271 9:120894783-120894805 CCCTATCCCAGCGCCCAGGTGGG - Intronic
1060675914 9:125514346-125514368 GCCTCCCCCAGCCTCGAGGCAGG + Intronic
1061994305 9:134176035-134176057 TGCTTCCCCTGCCTCCAGGTGGG - Intergenic
1062211362 9:135366039-135366061 GCCTTCCCAAGCCTCCAGACTGG + Intergenic
1186805820 X:13139356-13139378 GTCTTCCCCAGCCTGAAGGTGGG - Intergenic
1187683418 X:21792099-21792121 GGCTTCTCCAGCATCCAGGCTGG - Intergenic
1188756498 X:33969378-33969400 GCTTTCCCCAGCTTGAAGGTGGG - Intergenic
1190360569 X:49644974-49644996 GCCTTCCCCAGCCTGAAGGTAGG + Intergenic
1190439352 X:50462204-50462226 ACCTTCCCCATCATCCAGGTAGG - Intronic
1190914215 X:54798321-54798343 GCCTTCCCCACCCTTCAGGATGG - Intergenic