ID: 1041355204

View in Genome Browser
Species Human (GRCh38)
Location 8:56993195-56993217
Sequence CGCCTTCCCCAGCGTCCAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041355204_1041355208 4 Left 1041355204 8:56993195-56993217 CCACCTGGACGCTGGGGAAGGCG 0: 1
1: 0
2: 0
3: 25
4: 192
Right 1041355208 8:56993222-56993244 TGAGCAGGTAGAACATCTTGCGG 0: 1
1: 0
2: 0
3: 12
4: 136
1041355204_1041355209 8 Left 1041355204 8:56993195-56993217 CCACCTGGACGCTGGGGAAGGCG 0: 1
1: 0
2: 0
3: 25
4: 192
Right 1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 65
1041355204_1041355210 26 Left 1041355204 8:56993195-56993217 CCACCTGGACGCTGGGGAAGGCG 0: 1
1: 0
2: 0
3: 25
4: 192
Right 1041355210 8:56993244-56993266 GTTGGACAGCACGTCGCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041355204 Original CRISPR CGCCTTCCCCAGCGTCCAGG TGG (reversed) Exonic
902436116 1:16398988-16399010 TCCCTTCCCCAGCGGCCTGGAGG + Intronic
903135384 1:21306056-21306078 TGACATCCCCAGCGTCCAGGAGG - Intronic
903651782 1:24926989-24927011 CTCCTGCCCCAGAGTCAAGGCGG - Intronic
904361019 1:29971841-29971863 CAGCCTCCCCAGCCTCCAGGAGG + Intergenic
904403985 1:30274484-30274506 GGCCTTCCCCAGCCTGAAGGTGG + Intergenic
904716472 1:32471404-32471426 GGCCTTGCCAAGCGGCCAGGCGG + Exonic
905890688 1:41516690-41516712 CGGCTGCCCCCGCGTCCAGCGGG + Intronic
906223605 1:44103247-44103269 CGGCTGCCCCAGAGTCCGGGAGG - Intergenic
906559466 1:46745674-46745696 TGCCTTCCTCAGTCTCCAGGGGG + Intergenic
910137093 1:83985118-83985140 TGTCTTCCCCAGCTTACAGGCGG - Intronic
912453163 1:109779901-109779923 CCCCTACCCCAGTGTCCAGAGGG - Intergenic
913017976 1:114758194-114758216 CGCCACCCCTAGTGTCCAGGAGG - Intronic
914845401 1:151281293-151281315 CCCTTTCCCCCGCCTCCAGGGGG + Intronic
918348996 1:183635182-183635204 CGCCTTCCCCAGCGCCGCGAGGG + Intronic
919822629 1:201482573-201482595 TGCCTTTCTCAGAGTCCAGGAGG + Intergenic
922572670 1:226643154-226643176 TACCTTCCCCAGTGTCTAGGTGG - Intronic
1064263868 10:13808812-13808834 CACCTGCCCCAGAGTCTAGGTGG - Intronic
1069719982 10:70543814-70543836 CCCCTTTCCCAGCTCCCAGGAGG + Intronic
1072821686 10:98564664-98564686 TGCCTTGCCCTGCCTCCAGGAGG - Intronic
1074343075 10:112653440-112653462 TGCCTTCCCCAGCACACAGGTGG - Intronic
1075047817 10:119159837-119159859 CCTCTTCCCCAGCTTCCAGAAGG + Intronic
1076146396 10:128125963-128125985 CGCCCTCGCCAGAGCCCAGGAGG + Intronic
1076309629 10:129495905-129495927 TGTCCTCCCCAGCGTCCAGCAGG + Intronic
1076646176 10:131956398-131956420 GGCCTTCCTCCGAGTCCAGGTGG + Exonic
1077261727 11:1625548-1625570 CCCCTTCCACAACCTCCAGGTGG + Intergenic
1084173171 11:67410219-67410241 CACCTTCCCCAGCGGCCAGTGGG - Intronic
1084643628 11:70441391-70441413 CGCCGTGCCCAGCCTCCATGTGG - Intergenic
1087107318 11:94423517-94423539 GGCCTGCCCCAGCATTCAGGTGG - Intronic
1088425150 11:109693888-109693910 CTGCTTCCCCAGCTTCTAGGTGG - Intergenic
1090831400 11:130423210-130423232 CCCCTTCCCCATCTCCCAGGAGG - Intronic
1091327472 11:134701798-134701820 AGCCTTCCCCTGGGTCCTGGCGG + Intergenic
1091888263 12:4031961-4031983 CGCCTTCCCCTTCGCCCATGAGG - Intergenic
1095918475 12:47504693-47504715 CACTTTCCCCAGAGGCCAGGTGG - Intergenic
1096085515 12:48862848-48862870 CTCCTTCCCCAGGGTGGAGGGGG - Intronic
1096748718 12:53745290-53745312 CACCTTCCCCAGAATCCAGGAGG - Intergenic
1097446507 12:59678725-59678747 GGCCTTCCCCAGCTTGAAGGTGG + Intronic
1098039641 12:66341052-66341074 CTCCTTCCCCAGCTTGCAGATGG - Exonic
1102519804 12:113471254-113471276 CCCCTTCCCCAGCGCCCCAGTGG + Intronic
1103210077 12:119159192-119159214 CACTTAACCCAGCGTCCAGGAGG + Exonic
1108732172 13:53246512-53246534 CTCCTTCCCCAGCTTGCAGATGG - Intergenic
1111091573 13:83453446-83453468 CGCCTTCCACCGGGGCCAGGTGG + Intergenic
1112430533 13:99346700-99346722 GGCCTTCCCCAGCTTCCTGGGGG + Intronic
1113314026 13:109159763-109159785 CTCCTTCTCCAGCGTCCAGCAGG - Intronic
1117140909 14:52790926-52790948 CGCTTTCCCCAGGGTACAGAGGG - Intronic
1118200108 14:63663676-63663698 CGCCTTCCCCAGCTTGAAGGCGG + Intergenic
1119759651 14:77141520-77141542 CGGCTTCCCGTGCGTCCGGGAGG - Intronic
1120051822 14:79876127-79876149 CTCCTTCCTCAGTGTCCATGGGG + Intergenic
1122548446 14:102537696-102537718 GGCCTTATCCAGCCTCCAGGAGG + Intergenic
1122891114 14:104732708-104732730 CGCCTGCCCCCCCGCCCAGGCGG + Intronic
1122900522 14:104780470-104780492 CTCCATCCCCTGCGTCCAGCTGG - Intronic
1123117884 14:105902852-105902874 GGCCTGCCCCAGAGCCCAGGAGG - Intergenic
1125767013 15:42142651-42142673 CCCCTTCCCTAGCATCGAGGTGG - Exonic
1128430803 15:67591482-67591504 CTCCTGCCCCAGCCTCCAGCTGG + Intronic
1128699517 15:69794121-69794143 CGCCTTTCCCAGCCTCCAGCAGG + Intergenic
1129393498 15:75232348-75232370 CCCCTCCTCCAGCGTGCAGGTGG - Intergenic
1130537677 15:84798726-84798748 GGCCTACCCCAGCGGCCAGAAGG - Exonic
1131036729 15:89227303-89227325 CACCTTCCCCAGGAGCCAGGGGG - Intergenic
1131867081 15:96722522-96722544 AGCCTTTCCCAGGGGCCAGGAGG + Intergenic
1132329849 15:101004685-101004707 CGGCTTGCCCAGAGTCCACGTGG + Intronic
1132606335 16:795332-795354 CACCTTCCCCAGCAGCCAGCAGG + Exonic
1132625846 16:891122-891144 TGCCTTCCCCTGTGTCCACGTGG - Intronic
1132698489 16:1212351-1212373 CCCCATCCCCAGCGCCCAAGAGG + Intronic
1132730355 16:1357967-1357989 AGCCTTCCCCACAGTCCTGGAGG + Intronic
1132736469 16:1388432-1388454 GGCCTTCCCCAGCCTACTGGAGG + Intronic
1132982019 16:2743109-2743131 AGCCTCCCCCAGCGTCCAGCTGG - Intergenic
1133211191 16:4264202-4264224 CCCCTTCGCCAGCCTGCAGGCGG + Intronic
1133269307 16:4602712-4602734 CACCTTCCCAAGCCCCCAGGTGG - Intergenic
1133742734 16:8663565-8663587 GACCTCCCCCAGCCTCCAGGTGG - Intergenic
1134492147 16:14703341-14703363 CGCCCTCACCAGCCTACAGGCGG - Intergenic
1134497528 16:14742463-14742485 CGCCCTCACCAGCCTACAGGCGG - Intronic
1135535084 16:23287631-23287653 CTCCTTCCTCATCCTCCAGGAGG - Intronic
1136613306 16:31380307-31380329 CCCCTCCTTCAGCGTCCAGGAGG + Exonic
1136620267 16:31423886-31423908 CCCCTCCTTCAGCGTCCAGGAGG + Exonic
1137036467 16:35573807-35573829 CCCCTTCTCCAGCCTCCAGGAGG - Intergenic
1139183106 16:64770677-64770699 AGCCTTCCCCAGCTTGAAGGTGG - Intergenic
1139489654 16:67279500-67279522 CTCCCTTCCCAGCGGCCAGGAGG + Exonic
1139514009 16:67442802-67442824 CCGCTCCCCCAGCATCCAGGAGG - Intronic
1141698963 16:85633719-85633741 CCCCGTCCCCAGAGTCCAGCTGG - Intronic
1141981800 16:87555174-87555196 GCCCATCGCCAGCGTCCAGGAGG + Intergenic
1143864449 17:9913702-9913724 CGCCATCCCCACGGTCCAAGGGG + Intronic
1144729876 17:17520150-17520172 CACACTCCCCAGCGGCCAGGAGG - Intronic
1145261263 17:21356064-21356086 AGCCTTCCTCAGCCTCCAGGAGG - Intergenic
1147189656 17:38731046-38731068 CGCCTTCCCTAGCACGCAGGTGG + Intronic
1148407024 17:47424253-47424275 CCTCTTCCCCGGCGTCCAAGGGG - Intronic
1148997706 17:51725627-51725649 CTCCTTCTCCAGCATCCTGGGGG + Intronic
1149654610 17:58303531-58303553 CTCCTTCCACAACATCCAGGAGG + Intronic
1151188877 17:72383180-72383202 CGCCCTCCCCAGAGGTCAGGAGG - Intergenic
1151655780 17:75495366-75495388 CGACATCCCCAGCTTCCTGGAGG + Exonic
1151817327 17:76477707-76477729 TGCCTTCCCGAGCTTCCTGGAGG - Exonic
1154954920 18:21243491-21243513 CGCCTCCCCCCGCCTCGAGGCGG + Intronic
1155164115 18:23218861-23218883 CCCCTTCCCCAGCCTCCATCAGG - Intronic
1155998493 18:32358225-32358247 CGCCTTCCCCATCTCACAGGTGG + Intronic
1156457431 18:37302638-37302660 CGCCTCCCCAGGCTTCCAGGTGG + Intronic
1160515886 18:79478976-79478998 CGGCAGCCCCAGCGTCCATGGGG - Intronic
1160597741 18:79988741-79988763 GTTCCTCCCCAGCGTCCAGGCGG + Intronic
1160689659 19:455739-455761 CGCCTTTCCCAGCGTCCTGAGGG + Intronic
1160717922 19:584806-584828 CCCCTTCCCCATCGTCCTGTTGG - Intergenic
1160755961 19:757318-757340 CAGCGTCCCCAGCATCCAGGCGG - Exonic
1160973580 19:1781125-1781147 CTCCCTCCCCAGCCTCGAGGTGG - Intergenic
1161408001 19:4101193-4101215 CGCCCTCCCCAGAGCCCCGGGGG - Intronic
1161597352 19:5157406-5157428 CCCCCTCCCAAGAGTCCAGGGGG + Intergenic
1161780896 19:6291147-6291169 GGCCTGCTCCAGAGTCCAGGAGG - Intergenic
1162111046 19:8399966-8399988 CGCCACCCGCAGCATCCAGGTGG + Exonic
1162802513 19:13118902-13118924 CACCTCCTCCAGCGCCCAGGCGG - Intronic
1163779823 19:19240310-19240332 CCCCTTCCCCAGCCTGGAGGTGG - Intronic
1163779873 19:19240475-19240497 CACCTTCCCCAGCCTGGAGGTGG - Intronic
1164427108 19:28151311-28151333 CTCCTTTCCCAACCTCCAGGAGG + Intergenic
1164811022 19:31155855-31155877 GGCCTTCCCCAACTTCCTGGAGG + Intergenic
1165242711 19:34481204-34481226 CGCCTTCCCCAGCAGTCAGATGG + Intergenic
1165349897 19:35269618-35269640 GGCCATCACCAGCGTCCAGCAGG + Exonic
1167074586 19:47240684-47240706 CCTTTTCCCCAGGGTCCAGGTGG + Intergenic
1167423812 19:49419217-49419239 CCCCTTCCCCAGCTCCCAGGGGG + Intergenic
1167524802 19:49977067-49977089 GGCCTTCCCCATCCTCCATGAGG - Intronic
1167637099 19:50661586-50661608 CCCCTTCCCCTGCGGCCTGGGGG + Intronic
1168058010 19:53874231-53874253 CCCCTTCCCCAGCTTCCTGTCGG + Exonic
925355347 2:3237113-3237135 CGCCCTCCCCATCTCCCAGGTGG - Intronic
926344283 2:11931044-11931066 TTCCTTCCCCAGTGCCCAGGAGG - Intergenic
927202430 2:20586311-20586333 CCCCTTCCCCAGCTTCAAGGTGG - Intronic
927874068 2:26642721-26642743 CTCCCTCCCCTGCCTCCAGGAGG + Intergenic
928115457 2:28542680-28542702 CCCCTTGCCCAGTGTCCTGGGGG - Intronic
932601123 2:73126682-73126704 CCCCGTCCCCACCGGCCAGGAGG + Intronic
934554502 2:95280224-95280246 TCCCTACCCCAGCTTCCAGGCGG + Intronic
937919943 2:127121967-127121989 ACCCTGCCCCAGGGTCCAGGTGG + Intergenic
940316805 2:152335468-152335490 CGCCCTCCGCCGCGCCCAGGCGG - Exonic
941795423 2:169593759-169593781 CTCCTGCCTCAGCCTCCAGGTGG + Intronic
946972686 2:225112647-225112669 GGCCTGCCCCAGCGACCAGAAGG - Intergenic
948525181 2:238567006-238567028 CACCTTCCTCTGCGTCCACGAGG - Intergenic
948606598 2:239139686-239139708 CGCCGTCCCCAGCATCCCGGCGG - Exonic
948666245 2:239536425-239536447 CACCTGCACCAGAGTCCAGGGGG - Intergenic
948981519 2:241497141-241497163 CTCCCTCCCCAGGCTCCAGGTGG + Intronic
1169130875 20:3165913-3165935 CGCCCTCCCCAGAGCCCAGGTGG + Exonic
1169664509 20:8019458-8019480 CTCCATCACCAGCGTCCAGTTGG + Exonic
1171255833 20:23688469-23688491 GGCATTTCCCAGCGTCCAGCAGG - Intronic
1173271242 20:41537523-41537545 CTTCTTCCTCAGCGTCCATGGGG - Intronic
1173606323 20:44334419-44334441 CACCTTCCCCAGCATCCAGCAGG + Intergenic
1174046765 20:47739317-47739339 GGCCTTCCCCAGATCCCAGGAGG - Intronic
1174741209 20:53015857-53015879 CACCTTGCCCAGTGTTCAGGGGG + Intronic
1175215374 20:57389590-57389612 CGCCTCCCCCGGCCTCTAGGGGG + Intergenic
1175842475 20:62038136-62038158 CTCCTGCCTCAGCCTCCAGGTGG + Intronic
1176300644 21:5097427-5097449 GGCCTTCCCGAGGTTCCAGGTGG + Intergenic
1179842769 21:44087975-44087997 CGCCTTTCCCAGCAGGCAGGCGG - Intronic
1179856398 21:44164554-44164576 GGCCTTCCCGAGGTTCCAGGTGG - Intergenic
1181808308 22:25388633-25388655 CGGCTTCACCAGAGTCCAGCGGG - Intronic
1182111824 22:27729171-27729193 CGCCTTGCCCAGCACGCAGGAGG + Intergenic
1183953881 22:41367932-41367954 TGCCACCCCCAGCGTACAGGGGG - Intronic
1185115976 22:48938430-48938452 CTCCTTCCGGAGCCTCCAGGAGG - Intergenic
950204456 3:11068018-11068040 GTCCTTGTCCAGCGTCCAGGAGG - Intergenic
950365150 3:12477856-12477878 CTCCTTCCCCAGCCTCCTCGAGG + Intergenic
951999615 3:28770991-28771013 CTCTTTCCCCAGCTTGCAGGTGG + Intergenic
952965488 3:38618511-38618533 CACCTTCCCCAACCTCCCGGTGG + Intronic
953331094 3:42053526-42053548 AGCCTACACCAGGGTCCAGGAGG - Intronic
953596495 3:44319090-44319112 CCCCTTCCCCCACGGCCAGGTGG + Intronic
953802030 3:46031642-46031664 GGCCTTCCCCAGCTTGAAGGTGG - Intergenic
954869335 3:53755889-53755911 CGACTACCCCACCGACCAGGAGG - Intronic
958195303 3:90235671-90235693 GGCCTTCCCCAGCCTGAAGGTGG - Intergenic
958418712 3:93907078-93907100 GGCCTTCCCCAGCCTGAAGGTGG - Intronic
967895895 3:194396314-194396336 TGCCTTCCCCAGCTCCCACGCGG - Exonic
968686026 4:1959373-1959395 CTCCTTACCCAGCCTCCAGGTGG - Intronic
969489691 4:7491980-7492002 TGCCCTGCCCAGCCTCCAGGAGG - Intronic
971859822 4:32088843-32088865 GGCCTGCTCCAGTGTCCAGGAGG + Intergenic
978429564 4:108619586-108619608 CGCCTTTCTCAGCTTCCTGGAGG + Intergenic
980745471 4:137007364-137007386 CACCCTCCCCAGAGGCCAGGAGG - Intergenic
981614966 4:146637100-146637122 CGCCTTCCCCAGCACTCTGGCGG + Intergenic
982158061 4:152540582-152540604 GGCCTTCCCCAGCCTAAAGGTGG + Intergenic
983228431 4:165106801-165106823 CCCTTTCCCCAGCTTGCAGGTGG + Intronic
984685660 4:182665605-182665627 CACCGTGCCCAGCCTCCAGGAGG - Intronic
986402739 5:7395931-7395953 CGCCGTCCCCAGCCTGCAGCCGG + Intergenic
987745575 5:21967438-21967460 CTCCTTCCCCAGCCTCCAAGTGG - Intronic
991765776 5:69977566-69977588 CTCCTTCCCCAGCCTCCAAGTGG - Intergenic
991781546 5:70140596-70140618 CTCCTTCCCCAGCCTCCAAGTGG + Intergenic
991845011 5:70852637-70852659 CTCCTTCCCCAGCCTCCAAGTGG - Intergenic
991873989 5:71140910-71140932 CTCCTTCCCCAGCCTCCAAGTGG + Intergenic
993703357 5:91143725-91143747 GGCCTTCCCCAGCTTGAAGGTGG + Intronic
1001059589 5:168477175-168477197 CGCCCTCCCTAGCTTCCAGTAGG + Intergenic
1002582058 5:180215001-180215023 CGCTTTCCCCAGGACCCAGGAGG - Intergenic
1002981578 6:2143433-2143455 TTCCTGCCCCAGCATCCAGGTGG + Intronic
1003525166 6:6891176-6891198 CTCCTCCCCCAGCAGCCAGGTGG - Intergenic
1015539115 6:134296937-134296959 CGGCTGCCCCAGAGCCCAGGAGG - Intronic
1017766795 6:157613552-157613574 TGCCATCCCCAGGGTCCCGGAGG - Intronic
1018091056 6:160347652-160347674 GGGCTTGCTCAGCGTCCAGGAGG - Intergenic
1018682403 6:166275317-166275339 TTCCTTCCCCAGCGTCCTGTTGG + Intergenic
1019737109 7:2656094-2656116 CCCCCTCCTCCGCGTCCAGGAGG + Exonic
1021992748 7:26152987-26153009 CCTCTTCCCCGGCGTCCAAGGGG - Exonic
1024530416 7:50387510-50387532 CTCCTTCCCCACCGTGCTGGGGG - Intronic
1026944539 7:74307243-74307265 CGCTGTCCCCAGAGGCCAGGGGG + Intronic
1028268717 7:88759843-88759865 CGCCTCCCCCTGCGTCCTGCTGG + Exonic
1028684172 7:93574664-93574686 CTACCTCCCCAGAGTCCAGGAGG + Intronic
1029170945 7:98628631-98628653 CGCCTTCTCCTCTGTCCAGGAGG + Exonic
1029187065 7:98746878-98746900 CCCCTGCCCCAGGGTCCAGTGGG - Intergenic
1032267985 7:130381683-130381705 GCCCTTCCCCAGCATCCAGGCGG + Exonic
1033460926 7:141546909-141546931 CTCCTGCCTCAGCCTCCAGGTGG + Intergenic
1034210418 7:149358198-149358220 GGCCTTCCCCAGCTTGAAGGTGG + Intergenic
1035457905 7:159021243-159021265 GGCCTTCCCCAGCCTGAAGGTGG + Intergenic
1036688879 8:10928778-10928800 CTCCTTCTCCACCTTCCAGGCGG + Intronic
1041355204 8:56993195-56993217 CGCCTTCCCCAGCGTCCAGGTGG - Exonic
1044849873 8:96417750-96417772 TGCCTCCTCCAGAGTCCAGGAGG - Intergenic
1046547163 8:115667708-115667730 CGCCTTCTCCAGAGCCCAGCTGG + Intronic
1046946593 8:119979755-119979777 CCCCTTCCCCAGTGGCCTGGAGG - Intronic
1048468427 8:134686260-134686282 AGCCTAACCCAGGGTCCAGGTGG + Intronic
1048946444 8:139452774-139452796 CTCCTGGCCCAGCGTCCAGTAGG + Intergenic
1048993320 8:139774098-139774120 GGCCTTCGCCCGCGTCCATGTGG - Intronic
1049005413 8:139852411-139852433 CGCCTTCCCCACTGGACAGGAGG + Intronic
1049203448 8:141352598-141352620 TGCCTGCCCCAGCTTCCTGGAGG - Intergenic
1056777689 9:89525742-89525764 CGCCTTCCCATTTGTCCAGGTGG + Intergenic
1056943872 9:90977413-90977435 CTCGTTCTCCAGCCTCCAGGAGG - Intergenic
1058968472 9:110058537-110058559 TTCCTCCCCCAGCCTCCAGGTGG - Intronic
1059351166 9:113665975-113665997 CGCCTTCCCCAGCAGGCAGTGGG + Intergenic
1059665791 9:116445586-116445608 CTTCTTCCCCAGCATCCTGGGGG - Intronic
1060600395 9:124873554-124873576 CACCTTCCACGGCTTCCAGGGGG - Intronic
1060730116 9:126031634-126031656 TGCTTTCCCCACCCTCCAGGCGG + Intergenic
1061397058 9:130349031-130349053 CCACTTCCCCAGGATCCAGGAGG + Intronic
1061716307 9:132520699-132520721 TGCCTTCCCCTGCCTCCAGGAGG + Intronic
1061748472 9:132757325-132757347 CTCCTTCCCCAGAGGCCAGCGGG - Intronic
1062289387 9:135787692-135787714 CACCTTCCCCAGCGCCCACAGGG - Intronic
1186922144 X:14293866-14293888 CTCCTGCCTCAGCCTCCAGGTGG + Intergenic
1190245180 X:48686101-48686123 CCCCTGCCCCTGCATCCAGGTGG + Exonic
1192201775 X:69070986-69071008 TGCCTTCTCCAGCGTCCACGTGG + Intergenic
1201337884 Y:12899971-12899993 CTCCTACCTCAGCCTCCAGGTGG - Intergenic