ID: 1041355206

View in Genome Browser
Species Human (GRCh38)
Location 8:56993198-56993220
Sequence GACCGCCTTCCCCAGCGTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041355206_1041355208 1 Left 1041355206 8:56993198-56993220 CCTGGACGCTGGGGAAGGCGGTC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1041355208 8:56993222-56993244 TGAGCAGGTAGAACATCTTGCGG 0: 1
1: 0
2: 0
3: 12
4: 136
1041355206_1041355209 5 Left 1041355206 8:56993198-56993220 CCTGGACGCTGGGGAAGGCGGTC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 65
1041355206_1041355210 23 Left 1041355206 8:56993198-56993220 CCTGGACGCTGGGGAAGGCGGTC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1041355210 8:56993244-56993266 GTTGGACAGCACGTCGCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041355206 Original CRISPR GACCGCCTTCCCCAGCGTCC AGG (reversed) Exonic
900087060 1:903837-903859 GACAGCCTTGCCCAGCCTCAGGG - Intergenic
900662261 1:3790652-3790674 GCCTGGCTTCCCCAGTGTCCTGG - Intronic
901607752 1:10472527-10472549 GACCCCCTTCCGCAGCCTGCCGG + Intronic
904248305 1:29203940-29203962 CACCGCCTTCCCCAATGGCCAGG - Intronic
906134997 1:43492619-43492641 GTCCTCCTTCCTCAGCCTCCAGG + Intergenic
908092865 1:60704921-60704943 GACTGCCTTCCCCCACTTCCAGG - Intergenic
915592575 1:156879053-156879075 GATCGCCTTCCTCAGGCTCCTGG + Intronic
916305185 1:163322138-163322160 CACCGCCAGGCCCAGCGTCCCGG - Exonic
918458804 1:184754855-184754877 GAGCGCCTCCCCCAGCTTTCCGG + Exonic
922453535 1:225755925-225755947 GGCCCCCTGCCCCAGCATCCAGG + Intergenic
1062812907 10:478946-478968 GCCCTCCTTCCCCAGCACCCAGG + Intronic
1064310518 10:14208348-14208370 GACAGCCCTCCCCAGAGACCTGG - Intronic
1065814514 10:29472000-29472022 GTCCTCCTTCCTCAGCCTCCTGG - Intronic
1067575094 10:47403938-47403960 TACCTCCTTCCCCAGAGTGCGGG + Intergenic
1073108180 10:101045097-101045119 GACATCCTTCCCCATCCTCCAGG - Intergenic
1074769541 10:116724476-116724498 GACCCCCTTCCCCATGGTGCTGG + Intronic
1076335534 10:129704035-129704057 GGCCGCCTTCCCCAGGGATCAGG + Intronic
1077180167 11:1208670-1208692 GGCCACCTTCCCCAGTGGCCCGG - Intergenic
1077436032 11:2539674-2539696 TCCCGCCTTCCCCATAGTCCAGG + Intronic
1083159753 11:60847819-60847841 GACCTTCTTCCCCAGAGCCCAGG - Intronic
1083171558 11:60926564-60926586 GACTGTCTTCCCCAGGCTCCTGG + Intronic
1083933406 11:65857991-65858013 CACCCCCTCCCCCAGCGCCCCGG - Intronic
1084654482 11:70507163-70507185 GCCCGCCCGCCCCAGCCTCCTGG + Intronic
1085198554 11:74687387-74687409 GACAGCCTTCCTCAGCATCCTGG + Intergenic
1085423277 11:76381338-76381360 AACCGCCTGCTCTAGCGTCCCGG - Exonic
1085448407 11:76616233-76616255 GACTGCCTTCTCCAGCCTTCTGG + Intergenic
1087768422 11:102181039-102181061 GACCTCCTGCCTCAGCTTCCTGG - Intronic
1089384832 11:118060674-118060696 GACCCCCTTCTACAGAGTCCAGG + Intergenic
1096127309 12:49129450-49129472 GACCTCCTGTCCCAGCATCCTGG + Intronic
1101606699 12:106252235-106252257 GACCACCTTTCCCAGCCTCAGGG + Intronic
1106120683 13:26857992-26858014 GACTTCCATCCCCAGGGTCCTGG + Intergenic
1110558497 13:76886208-76886230 AACCGCCTTCCCCGGAGCCCCGG + Exonic
1112430530 13:99346697-99346719 GGAGGCCTTCCCCAGCTTCCTGG + Intronic
1113408770 13:110065413-110065435 GACCCCCCACCCCAGCATCCTGG + Intergenic
1113648087 13:112012917-112012939 CACCTCGTTCCCCAGGGTCCAGG + Intergenic
1114069898 14:19098184-19098206 GAACGCTCTTCCCAGCGTCCCGG - Intergenic
1114092363 14:19301818-19301840 GAACGCTCTTCCCAGCGTCCCGG + Intergenic
1114655052 14:24310921-24310943 GCCCGCCTGGCCCAGCGGCCAGG - Exonic
1117943183 14:60990718-60990740 GACCTCCTGCCTCAGCCTCCCGG + Intronic
1119143798 14:72292140-72292162 GCCTGCCTTCCCCAGTGTACTGG + Intronic
1121325874 14:93019293-93019315 CACCTCCTTCCCCAGCGCCAAGG - Intronic
1121730200 14:96181518-96181540 GACTGCCCTCCCCAGTGTACAGG + Intergenic
1122922959 14:104887493-104887515 CACCGCCATCCCCAGCTGCCCGG + Exonic
1123115435 14:105892230-105892252 GGCCCCCTTCCCCTGGGTCCAGG - Intergenic
1124724835 15:32147444-32147466 ATCCGCCTTCCTCAGCCTCCTGG - Intronic
1128733006 15:70033688-70033710 GACCCCCTACCCCAGCGGGCGGG + Intergenic
1130253558 15:82315616-82315638 GGCCGCCCTCCCCAGGGCCCCGG + Intergenic
1132154610 15:99486656-99486678 GACAGCCATGCCCAGCGCCCTGG - Intergenic
1132601724 16:775808-775830 GACCCCCAACCCCAGCGTCGTGG - Intronic
1133260690 16:4547879-4547901 GTCCTCCTTCCTCAGCTTCCTGG + Intergenic
1139526211 16:67518445-67518467 GACAGCCCTCACCAGCATCCTGG + Intronic
1141171279 16:81693323-81693345 CACCGCCTTGCCCAGCTCCCTGG + Intronic
1142117927 16:88369815-88369837 GACCCCCAGCCCCAGCTTCCGGG + Intergenic
1142215527 16:88827899-88827921 GACAGCCCTCCCCACGGTCCAGG + Intronic
1142741906 17:1936508-1936530 GACCGCCAGCCCCAGTGTCCAGG + Exonic
1142761053 17:2042124-2042146 CAGCGCCTTCCTCAGCGCCCCGG - Exonic
1143110454 17:4549963-4549985 GCCCGCCCTCCACAGCGTCCTGG - Intronic
1144128560 17:12224253-12224275 AACAGTCTTCCCCAGTGTCCAGG - Intergenic
1144339004 17:14297585-14297607 CTCCGCCTTCTCCAGCGGCCCGG - Intergenic
1146079075 17:29761069-29761091 AGCCGCTTTCCCCAGCATCCTGG - Intronic
1147567358 17:41546027-41546049 CCCTGCCTTCCCCAGCCTCCAGG - Intergenic
1149651453 17:58278895-58278917 GCCAGCCTTCCTCAGCGTCTGGG + Intronic
1149655097 17:58305790-58305812 TATCTCCTTCCCCAGCCTCCCGG + Intronic
1152596896 17:81242195-81242217 GACCCGCCTCCCCAGCGTGCAGG + Intergenic
1152755152 17:82084135-82084157 GGCCGCCTCCTCCAGCGTCCTGG + Exonic
1159829048 18:73250377-73250399 GAGCCTCTTCCCCAGCGGCCAGG + Intronic
1160432023 18:78819189-78819211 GACCGGCTCCCCCACCCTCCAGG - Intergenic
1160562465 18:79767244-79767266 GACAGCTTTGCCCAGCATCCAGG + Intergenic
1161249020 19:3270659-3270681 GCCCGCCTTACCCACCGGCCTGG - Intronic
1161316893 19:3621414-3621436 GACCACCTTCCTCAGGCTCCCGG + Intronic
1161408006 19:4101196-4101218 GCCCGCCCTCCCCAGAGCCCCGG - Intronic
1162327485 19:10007596-10007618 GACCCCCTGCCCCAGCCTCTTGG + Intronic
1162472700 19:10881972-10881994 GAGCCCCTCCCCCAGCATCCTGG - Intronic
1162796633 19:13090618-13090640 GGCCGCCTTCCCCAGGGCCAGGG - Intronic
1165244912 19:34493328-34493350 GAGCCCCTGCCCCAGCCTCCTGG + Intronic
1165690030 19:37855935-37855957 GACTGCATCCGCCAGCGTCCAGG + Intergenic
1166785316 19:45363777-45363799 GCCCGCCTTCCTGAGCGGCCTGG - Exonic
1167577351 19:50324163-50324185 TGCCCCCTTCCCCAGCCTCCTGG + Intronic
1167637094 19:50661583-50661605 CACCCCCTTCCCCTGCGGCCTGG + Intronic
1168103875 19:54155287-54155309 GACCGCCTTCTCCCCCGGCCAGG + Exonic
1168133823 19:54337549-54337571 GATGGCCTCCCCCAGCGCCCTGG - Exonic
1168336293 19:55599428-55599450 GACGGACTTCCCCGGCCTCCCGG - Intronic
927706451 2:25299315-25299337 GACTTCCTTCCCCAGGGCCCTGG + Intronic
929787691 2:45004122-45004144 GACCGCGTCCCTCAGCGACCAGG - Intergenic
931229652 2:60363640-60363662 GTCCTTCTTCTCCAGCGTCCTGG + Intergenic
932599291 2:73112840-73112862 GACCGCCTTCTGCCGCGGCCGGG - Exonic
932699440 2:73983545-73983567 GACAGCCTGCTCCAGGGTCCAGG - Intergenic
932713704 2:74086241-74086263 CACCTCCTTCCCCAGCTCCCAGG + Intronic
947771909 2:232676741-232676763 GCCAGCCTTCCCCACAGTCCTGG - Intronic
947918647 2:233850910-233850932 CACAGCCTCCCCCAGCCTCCAGG + Intronic
948606601 2:239139689-239139711 GCCCGCCGTCCCCAGCATCCCGG - Exonic
1168794842 20:604567-604589 GGCCTCCTTCTCCAGGGTCCAGG + Exonic
1172187754 20:33041887-33041909 GACCCCCTTCTCCAGCGCCAGGG + Intronic
1172245701 20:33443740-33443762 GAGCTCCTCCCCCAGCGGCCGGG - Exonic
1172595858 20:36150842-36150864 TCCAGCCTTCCCCAGTGTCCAGG + Intronic
1172966026 20:38835900-38835922 CACCGCCCTCCCCAACGCCCTGG - Exonic
1175047655 20:56122455-56122477 GACCCCCACCCCCAGCGCCCTGG + Intergenic
1175364706 20:58444627-58444649 GACCGCACTCCCCAGCATGCTGG - Exonic
1180488365 22:15820748-15820770 GAACGCTCTTCCCAGCGTCCCGG - Intergenic
1180876509 22:19177600-19177622 GCCGGCCTTCCCTGGCGTCCAGG + Intronic
1182397157 22:30044999-30045021 GACCTCCTTCTCCTGCGTCTAGG + Intergenic
1183621008 22:38972604-38972626 GACAGCCTGCCCAAGCCTCCAGG - Intronic
1184118011 22:42433154-42433176 GACCCCCTTCCCCAGCAGACTGG + Intergenic
952316771 3:32238685-32238707 CACCGCCTTCCCCGGCTGCCCGG + Exonic
962989634 3:140566359-140566381 GAAGGCCTTCTCCAGCTTCCTGG + Exonic
967930736 3:194688245-194688267 GACCGCTTTCCCCTACCTCCCGG + Exonic
968443509 4:636424-636446 GGCCTCCCTCCCCAGCGTCTCGG - Intronic
968625123 4:1623533-1623555 GCCCGCCTTCCCCGGCGGCCTGG + Intronic
968681555 4:1924336-1924358 CACCGCCTTACCCTGCTTCCAGG - Intronic
969198719 4:5584703-5584725 CACCGCCCTCCTCAGCATCCAGG - Exonic
972245931 4:37245172-37245194 GCCCGCCGGCCGCAGCGTCCGGG + Exonic
980122899 4:128745949-128745971 GTCCTCCTACCCCAGCCTCCTGG + Intergenic
983441973 4:167798064-167798086 GAGCTCCATGCCCAGCGTCCTGG + Intergenic
984952882 4:185019751-185019773 CTCCGCCTTCTCCAGCTTCCCGG - Exonic
985843268 5:2325634-2325656 TCCCGCCCTCCCCATCGTCCTGG - Intergenic
990954607 5:61330780-61330802 CTCCGCCTTCGCCCGCGTCCAGG + Intergenic
992068679 5:73129960-73129982 GACCCCCTCCCCCAGGCTCCTGG - Intronic
998573537 5:143288576-143288598 GACCTCCCTCCTCAGCCTCCTGG + Intronic
999317710 5:150594912-150594934 GACCTCCTTCCACAGCATCCAGG - Intergenic
1000920194 5:167129039-167129061 GAACACCTTCCCCAGCTTCCTGG + Intergenic
1002001763 5:176200046-176200068 GACAGCCTTCGTCAGCATCCAGG + Intergenic
1002174382 5:177393298-177393320 GTGCCCCTTCCCCAGCATCCTGG - Intronic
1005559167 6:27020201-27020223 GTCCGCCTTCGCACGCGTCCGGG + Intergenic
1005626781 6:27669865-27669887 GACCTCCTTTCTCAGCGACCAGG - Intergenic
1006787517 6:36678595-36678617 GACCGCCCTCCCCGGGGCCCAGG - Intronic
1007886180 6:45232878-45232900 GTTCGCCTGCCCCAGCCTCCAGG + Intronic
1018191419 6:161312221-161312243 CACCGCCTTCTCCAGAGTCGTGG - Intergenic
1018366281 6:163123132-163123154 CACCGCCTCCTCCAGCCTCCAGG - Intronic
1019314312 7:377414-377436 GACGGCCTTCTCCAGCGAGCAGG + Intergenic
1019330517 7:458455-458477 GACCTCCGTCCCCACTGTCCAGG - Intergenic
1019647255 7:2137676-2137698 GAGCGCTTTCCCCATGGTCCCGG + Intronic
1024530421 7:50387513-50387535 GCCCTCCTTCCCCACCGTGCTGG - Intronic
1025209022 7:57010156-57010178 CACCGGCTTCACCAGCCTCCCGG + Intergenic
1025662928 7:63566700-63566722 CACCGGCTTCACCAGCCTCCCGG - Intergenic
1026946372 7:74318892-74318914 GACCCCCTTCCCCAGGACCCAGG - Intronic
1037305235 8:17497288-17497310 CCCCGCCGGCCCCAGCGTCCGGG - Intronic
1039965541 8:42281149-42281171 GCCTCCCTTCCCCAGCGTTCGGG - Intronic
1041355206 8:56993198-56993220 GACCGCCTTCCCCAGCGTCCAGG - Exonic
1042926970 8:73976459-73976481 GCGCGCCTTCTCCGGCGTCCGGG + Exonic
1049396621 8:142403818-142403840 GACCTCCTTCCGCAGGGGCCTGG + Intergenic
1053456811 9:38239357-38239379 GACTGCCTTCCCCAGTGTGAGGG + Intergenic
1056684309 9:88746930-88746952 GACAGCCTTCCTCAGAGCCCCGG - Intergenic
1058060324 9:100488765-100488787 GACCACCTTGTCCAGCATCCCGG - Intronic
1060983465 9:127806925-127806947 GACTCCCTTCCCGAGCGTCCTGG - Intronic
1186605905 X:11090933-11090955 GACCCCCTTCCCCAGCATGATGG + Intergenic
1188164481 X:26845126-26845148 GCCCTCCTTCCTCAGCCTCCTGG - Intergenic
1190324825 X:49200013-49200035 GACCCCCATCCCCAGCGCCGGGG + Intronic
1199736759 X:150693215-150693237 GACCTCCTGCTCCAGCGACCTGG - Intronic
1200213402 X:154356817-154356839 GACCCCCATCCCCACCTTCCAGG - Intronic