ID: 1041355209

View in Genome Browser
Species Human (GRCh38)
Location 8:56993226-56993248
Sequence CAGGTAGAACATCTTGCGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041355198_1041355209 18 Left 1041355198 8:56993185-56993207 CCGTGGGCTCCCACCTGGACGCT 0: 1
1: 0
2: 1
3: 25
4: 190
Right 1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 65
1041355197_1041355209 19 Left 1041355197 8:56993184-56993206 CCCGTGGGCTCCCACCTGGACGC 0: 1
1: 0
2: 2
3: 11
4: 169
Right 1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 65
1041355203_1041355209 9 Left 1041355203 8:56993194-56993216 CCCACCTGGACGCTGGGGAAGGC 0: 1
1: 0
2: 0
3: 25
4: 219
Right 1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 65
1041355196_1041355209 22 Left 1041355196 8:56993181-56993203 CCGCCCGTGGGCTCCCACCTGGA 0: 1
1: 0
2: 1
3: 20
4: 205
Right 1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 65
1041355204_1041355209 8 Left 1041355204 8:56993195-56993217 CCACCTGGACGCTGGGGAAGGCG 0: 1
1: 0
2: 0
3: 25
4: 192
Right 1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 65
1041355206_1041355209 5 Left 1041355206 8:56993198-56993220 CCTGGACGCTGGGGAAGGCGGTC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041355209 Original CRISPR CAGGTAGAACATCTTGCGGT TGG Exonic
904810663 1:33161524-33161546 CAGGAAGAACTGCTGGCGGTGGG + Intronic
920564729 1:206964284-206964306 GTGGTTCAACATCTTGCGGTAGG + Intronic
920653816 1:207859787-207859809 CAGGAAGAACATATTGGGGAGGG + Intergenic
1071055502 10:81504279-81504301 AAGGTAGAATATCTTGAAGTGGG + Intergenic
1071349314 10:84723643-84723665 CAGGTAAAACAACTTGGGGCGGG + Intergenic
1075573448 10:123561276-123561298 CAGGTAGAACAGCCTGAGGCAGG - Intergenic
1079315036 11:19400315-19400337 CAGGTAGAACCTCTGGTGGTGGG + Intronic
1080396127 11:31891660-31891682 TAGGGAGAACATCTTGCGAATGG + Intronic
1084944766 11:72632676-72632698 CAGGTAGCCCATCTGGCTGTGGG - Intronic
1086538971 11:87884917-87884939 CAGGTAGAACATTTAACTGTGGG + Intergenic
1086606434 11:88701701-88701723 AAGGTAGAACATCTTGAAGCAGG + Intronic
1088685873 11:112284293-112284315 CAGGTGGATCACCTTGGGGTCGG - Intergenic
1093471363 12:19505567-19505589 GAGGTGTAACATCTTGAGGTGGG + Intronic
1094724048 12:33094158-33094180 CCAGTAGAACATCTTGCACTTGG - Intergenic
1102703078 12:114856779-114856801 CAGGTAGCACATGTTTGGGTTGG - Intergenic
1107680282 13:42841314-42841336 CAGGTAAAAGATGTTGCAGTAGG - Intergenic
1108463031 13:50686417-50686439 CAGCTTGAACACCTTGAGGTTGG + Intronic
1108708615 13:53012050-53012072 CAGGTAGAACTTCTGGCTGGAGG + Intergenic
1109252638 13:60038442-60038464 CAGGTGGAACATCTTGATTTCGG - Intronic
1110373340 13:74764225-74764247 CAAGAAGAACATCTTCTGGTAGG + Intergenic
1120459973 14:84782483-84782505 CAGATTGAACATATTGCTGTTGG + Intergenic
1133631806 16:7629134-7629156 CAGGTAGAACCTCTGGCCCTGGG + Intronic
1134235939 16:12466628-12466650 CAGGTAGATCATGGTGAGGTAGG - Intronic
1137927405 16:52553658-52553680 TGGGTGGAACATCTTGAGGTAGG + Intergenic
1144812387 17:18008790-18008812 CAGACAGACCATCTTGGGGTGGG + Intronic
1146685293 17:34837377-34837399 CTGGTAGAACATCTTCAGGGTGG - Intergenic
1152361500 17:79835129-79835151 CAGGTCGTACATTTTGGGGTCGG + Exonic
1155636376 18:27960370-27960392 CAGGAAGAACATCTTGTAGATGG + Intronic
1155943543 18:31823653-31823675 AAGGCAGAACATCTTGAAGTGGG + Intergenic
1156159822 18:34346217-34346239 CAGGTACAACAACTTGGAGTTGG - Intergenic
1167188041 19:47961612-47961634 CTGGAAGAGCATCTTGCAGTGGG - Intergenic
1167748703 19:51367588-51367610 CAGCTAGCTCATCTTGCGGCTGG - Intronic
925232986 2:2252412-2252434 TAGGAAGAACAGCTTGTGGTGGG - Intronic
927241502 2:20923379-20923401 CAGGTGGGACATTTTGAGGTGGG + Intergenic
928603575 2:32924111-32924133 CAGGTAGATCATCTGACGTTGGG + Intergenic
933432405 2:82199854-82199876 AAGGCAGAACATCTTGAAGTGGG - Intergenic
936541951 2:113359469-113359491 CAGGTAGGAAATCTTGCAATTGG - Intergenic
938750064 2:134319986-134320008 CAGGAAGAACATCTACTGGTGGG - Intronic
940491743 2:154370622-154370644 AAGGAAGAACATTTTGGGGTTGG + Intronic
940969609 2:159881438-159881460 CAGGTAGAACATCTGCAGGCTGG + Intronic
942275586 2:174320476-174320498 CAGGTATAGCATCTTGCAGATGG + Intergenic
1176524731 21:7857551-7857573 AAGGTGGAACATCTTGAAGTGGG + Intergenic
1178658751 21:34487564-34487586 AAGGTGGAACATCTTGAAGTGGG + Intergenic
1183707569 22:39483846-39483868 CAGGTAGAACAATCTGGGGTAGG - Intronic
950920587 3:16690121-16690143 AAGGTAGGACATCTTGAAGTAGG + Intergenic
960285248 3:115820942-115820964 CAGGTAGAACATTTTCTGGAGGG + Intronic
961738286 3:129015783-129015805 CAGGAAGAACAGCTTGGGGTAGG - Intronic
968292541 3:197549749-197549771 CAAGTAGAACATGTTTAGGTAGG - Intronic
971087934 4:23300952-23300974 CAGGTAAAACATTTTACTGTGGG - Intergenic
971336450 4:25727924-25727946 CAGGCAGAACATCTTGCTGAGGG - Intergenic
973938282 4:55874531-55874553 CAGGAAAAACATCTTGCATTTGG + Intronic
977163394 4:93664627-93664649 CAGGAAGAATATTTTGGGGTGGG + Intronic
977761733 4:100746015-100746037 CAGGCAGATCATCAGGCGGTTGG + Intronic
990275560 5:54192298-54192320 TAGTTAGAACATGTTGTGGTGGG - Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
1001708310 5:173758112-173758134 CAGGTGGAAGATCTGGGGGTAGG + Intergenic
1016696591 6:147003309-147003331 CAGCTAAAACATTTTGCAGTAGG + Intergenic
1018619839 6:165719492-165719514 CTGGTTGAACATGTTGTGGTAGG + Intronic
1026843278 7:73682932-73682954 AAAGTTGAACATCGTGCGGTTGG + Exonic
1032689031 7:134264081-134264103 CAGGTAGAACATTCTTCCGTGGG - Exonic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1042766881 8:72331694-72331716 CGAGTACAACATCTTGGGGTAGG + Intergenic
1043483251 8:80673979-80674001 CAGGTAGAACATCATGGAGCTGG - Intronic
1049801756 8:144521003-144521025 CAGGTCCAACTTCTTGAGGTGGG - Exonic
1052287643 9:26804835-26804857 CAGGCAAAAAATCTTGCTGTTGG - Intergenic
1060075504 9:120587227-120587249 TAGGTAGGAGATCTTGCCGTGGG - Intergenic
1060725776 9:126005052-126005074 AAGTTAAAACATCTTGCTGTGGG - Intergenic
1061790405 9:133056049-133056071 CTGGTAGAACATCTGCCGATAGG - Exonic
1196327619 X:114426123-114426145 CAGGCAAAACATCTTGATGTGGG - Intergenic