ID: 1041357430

View in Genome Browser
Species Human (GRCh38)
Location 8:57014854-57014876
Sequence GGCTGCACACTCCGTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041357430_1041357439 18 Left 1041357430 8:57014854-57014876 CCAGCTCCACGGAGTGTGCAGCC No data
Right 1041357439 8:57014895-57014917 TACAGCTGGCATGATGGCAGTGG No data
1041357430_1041357438 12 Left 1041357430 8:57014854-57014876 CCAGCTCCACGGAGTGTGCAGCC No data
Right 1041357438 8:57014889-57014911 CCTTGCTACAGCTGGCATGATGG No data
1041357430_1041357435 4 Left 1041357430 8:57014854-57014876 CCAGCTCCACGGAGTGTGCAGCC No data
Right 1041357435 8:57014881-57014903 CTGTGCCTCCTTGCTACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041357430 Original CRISPR GGCTGCACACTCCGTGGAGC TGG (reversed) Intergenic
No off target data available for this crispr