ID: 1041358267

View in Genome Browser
Species Human (GRCh38)
Location 8:57022533-57022555
Sequence CTCCGTCAGGGAGGGAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041358253_1041358267 14 Left 1041358253 8:57022496-57022518 CCCATCTGGAGGGAGGTGGGGGC No data
Right 1041358267 8:57022533-57022555 CTCCGTCAGGGAGGGAGGTGGGG No data
1041358256_1041358267 -8 Left 1041358256 8:57022518-57022540 CCACCTGGCCAGCCACTCCGTCA No data
Right 1041358267 8:57022533-57022555 CTCCGTCAGGGAGGGAGGTGGGG No data
1041358247_1041358267 18 Left 1041358247 8:57022492-57022514 CCGCCCCATCTGGAGGGAGGTGG No data
Right 1041358267 8:57022533-57022555 CTCCGTCAGGGAGGGAGGTGGGG No data
1041358251_1041358267 15 Left 1041358251 8:57022495-57022517 CCCCATCTGGAGGGAGGTGGGGG No data
Right 1041358267 8:57022533-57022555 CTCCGTCAGGGAGGGAGGTGGGG No data
1041358245_1041358267 22 Left 1041358245 8:57022488-57022510 CCAGCCGCCCCATCTGGAGGGAG No data
Right 1041358267 8:57022533-57022555 CTCCGTCAGGGAGGGAGGTGGGG No data
1041358254_1041358267 13 Left 1041358254 8:57022497-57022519 CCATCTGGAGGGAGGTGGGGGCC No data
Right 1041358267 8:57022533-57022555 CTCCGTCAGGGAGGGAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041358267 Original CRISPR CTCCGTCAGGGAGGGAGGTG GGG Intergenic
No off target data available for this crispr