ID: 1041366932

View in Genome Browser
Species Human (GRCh38)
Location 8:57116348-57116370
Sequence CAGATACTCCCTTGTATTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041366932_1041366935 -9 Left 1041366932 8:57116348-57116370 CCTGGAATACAAGGGAGTATCTG No data
Right 1041366935 8:57116362-57116384 GAGTATCTGGGTTGAGAAAAAGG No data
1041366932_1041366938 7 Left 1041366932 8:57116348-57116370 CCTGGAATACAAGGGAGTATCTG No data
Right 1041366938 8:57116378-57116400 AAAAAGGGTTGTGGAGACTAAGG No data
1041366932_1041366937 -2 Left 1041366932 8:57116348-57116370 CCTGGAATACAAGGGAGTATCTG No data
Right 1041366937 8:57116369-57116391 TGGGTTGAGAAAAAGGGTTGTGG No data
1041366932_1041366936 -8 Left 1041366932 8:57116348-57116370 CCTGGAATACAAGGGAGTATCTG No data
Right 1041366936 8:57116363-57116385 AGTATCTGGGTTGAGAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041366932 Original CRISPR CAGATACTCCCTTGTATTCC AGG (reversed) Intergenic
No off target data available for this crispr