ID: 1041369634

View in Genome Browser
Species Human (GRCh38)
Location 8:57145000-57145022
Sequence GAGAATCAAGAGAAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041369631_1041369634 13 Left 1041369631 8:57144964-57144986 CCAGAGAAAGTTCTTTTTCAGTA No data
Right 1041369634 8:57145000-57145022 GAGAATCAAGAGAAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041369634 Original CRISPR GAGAATCAAGAGAAGGAGAC AGG Intergenic
No off target data available for this crispr