ID: 1041373491

View in Genome Browser
Species Human (GRCh38)
Location 8:57189370-57189392
Sequence GTGGTATAGCTAGGAAACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041373479_1041373491 17 Left 1041373479 8:57189330-57189352 CCACGAAACTGGTCCCTGGTGCC 0: 85
1: 651
2: 1117
3: 1570
4: 1330
Right 1041373491 8:57189370-57189392 GTGGTATAGCTAGGAAACAGTGG No data
1041373487_1041373491 -4 Left 1041373487 8:57189351-57189373 CCAAAAAGGCCGGGGTCTGGTGG No data
Right 1041373491 8:57189370-57189392 GTGGTATAGCTAGGAAACAGTGG No data
1041373485_1041373491 3 Left 1041373485 8:57189344-57189366 CCTGGTGCCAAAAAGGCCGGGGT No data
Right 1041373491 8:57189370-57189392 GTGGTATAGCTAGGAAACAGTGG No data
1041373483_1041373491 4 Left 1041373483 8:57189343-57189365 CCCTGGTGCCAAAAAGGCCGGGG 0: 2
1: 108
2: 1132
3: 1721
4: 1438
Right 1041373491 8:57189370-57189392 GTGGTATAGCTAGGAAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041373491 Original CRISPR GTGGTATAGCTAGGAAACAG TGG Intergenic
No off target data available for this crispr