ID: 1041376029

View in Genome Browser
Species Human (GRCh38)
Location 8:57210016-57210038
Sequence CTGCATAGGGCCTCGTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041376029_1041376040 25 Left 1041376029 8:57210016-57210038 CCACAGAACGAGGCCCTATGCAG No data
Right 1041376040 8:57210064-57210086 CCCCCTGAGAAGTTGGTCCTGGG No data
1041376029_1041376042 26 Left 1041376029 8:57210016-57210038 CCACAGAACGAGGCCCTATGCAG No data
Right 1041376042 8:57210065-57210087 CCCCTGAGAAGTTGGTCCTGGGG No data
1041376029_1041376038 24 Left 1041376029 8:57210016-57210038 CCACAGAACGAGGCCCTATGCAG No data
Right 1041376038 8:57210063-57210085 GCCCCCTGAGAAGTTGGTCCTGG No data
1041376029_1041376037 18 Left 1041376029 8:57210016-57210038 CCACAGAACGAGGCCCTATGCAG No data
Right 1041376037 8:57210057-57210079 CCAAAAGCCCCCTGAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041376029 Original CRISPR CTGCATAGGGCCTCGTTCTG TGG (reversed) Intergenic
No off target data available for this crispr