ID: 1041376799

View in Genome Browser
Species Human (GRCh38)
Location 8:57214395-57214417
Sequence CTGCATAGGGCCTCGTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041376799_1041376809 25 Left 1041376799 8:57214395-57214417 CCACAGAACGAGGCCCTATGCAG No data
Right 1041376809 8:57214443-57214465 CCCCCTGAGCAGTTGGCCCTAGG No data
1041376799_1041376811 26 Left 1041376799 8:57214395-57214417 CCACAGAACGAGGCCCTATGCAG No data
Right 1041376811 8:57214444-57214466 CCCCTGAGCAGTTGGCCCTAGGG No data
1041376799_1041376806 18 Left 1041376799 8:57214395-57214417 CCACAGAACGAGGCCCTATGCAG No data
Right 1041376806 8:57214436-57214458 CCAAAACCCCCCTGAGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041376799 Original CRISPR CTGCATAGGGCCTCGTTCTG TGG (reversed) Intergenic
No off target data available for this crispr