ID: 1041380895

View in Genome Browser
Species Human (GRCh38)
Location 8:57253641-57253663
Sequence CCACCTATTAAGGTTATAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041380895_1041380904 17 Left 1041380895 8:57253641-57253663 CCTATTATAACCTTAATAGGTGG No data
Right 1041380904 8:57253681-57253703 TGGAGAACCACAACTCTGTAGGG No data
1041380895_1041380898 -3 Left 1041380895 8:57253641-57253663 CCTATTATAACCTTAATAGGTGG No data
Right 1041380898 8:57253661-57253683 TGGTGCTGATGCCCTCCACCTGG No data
1041380895_1041380907 26 Left 1041380895 8:57253641-57253663 CCTATTATAACCTTAATAGGTGG No data
Right 1041380907 8:57253690-57253712 ACAACTCTGTAGGGAAGGTGTGG No data
1041380895_1041380908 29 Left 1041380895 8:57253641-57253663 CCTATTATAACCTTAATAGGTGG No data
Right 1041380908 8:57253693-57253715 ACTCTGTAGGGAAGGTGTGGAGG No data
1041380895_1041380905 21 Left 1041380895 8:57253641-57253663 CCTATTATAACCTTAATAGGTGG No data
Right 1041380905 8:57253685-57253707 GAACCACAACTCTGTAGGGAAGG No data
1041380895_1041380903 16 Left 1041380895 8:57253641-57253663 CCTATTATAACCTTAATAGGTGG No data
Right 1041380903 8:57253680-57253702 CTGGAGAACCACAACTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041380895 Original CRISPR CCACCTATTAAGGTTATAAT AGG (reversed) Intergenic
No off target data available for this crispr